ID: 1137665301

View in Genome Browser
Species Human (GRCh38)
Location 16:50246103-50246125
Sequence GGGGAAGGAGGAGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137665301_1137665318 19 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665318 16:50246145-50246167 CCAGCCCGCTGCCACTGGGGCGG 0: 1
1: 0
2: 3
3: 17
4: 244
1137665301_1137665315 15 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665315 16:50246141-50246163 CGGGCCAGCCCGCTGCCACTGGG 0: 1
1: 0
2: 2
3: 19
4: 151
1137665301_1137665316 16 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665316 16:50246142-50246164 GGGCCAGCCCGCTGCCACTGGGG 0: 1
1: 0
2: 0
3: 14
4: 209
1137665301_1137665306 -5 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665306 16:50246121-50246143 TCCCCGCCCGCGGTGAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 95
1137665301_1137665321 27 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665321 16:50246153-50246175 CTGCCACTGGGGCGGCCACTCGG 0: 1
1: 0
2: 2
3: 23
4: 154
1137665301_1137665308 -4 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665308 16:50246122-50246144 CCCCGCCCGCGGTGAGTGCCGGG 0: 1
1: 0
2: 1
3: 16
4: 125
1137665301_1137665314 14 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665314 16:50246140-50246162 CCGGGCCAGCCCGCTGCCACTGG 0: 1
1: 0
2: 6
3: 66
4: 313
1137665301_1137665322 28 Left 1137665301 16:50246103-50246125 CCTGCGGCCGCTCCTCCTTCCCC No data
Right 1137665322 16:50246154-50246176 TGCCACTGGGGCGGCCACTCGGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137665301 Original CRISPR GGGGAAGGAGGAGCGGCCGC AGG (reversed) Intergenic
No off target data available for this crispr