ID: 1137665391

View in Genome Browser
Species Human (GRCh38)
Location 16:50246340-50246362
Sequence CCGGCCTCGCGGGTGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137665371_1137665391 22 Left 1137665371 16:50246295-50246317 CCCCACACAGGCGGGCGGGTGGC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665373_1137665391 20 Left 1137665373 16:50246297-50246319 CCACACAGGCGGGCGGGTGGCCC 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665380_1137665391 -8 Left 1137665380 16:50246325-50246347 CCGGCCCGCCCTTCCCCGGCCTC 0: 1
1: 0
2: 6
3: 145
4: 1041
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665379_1137665391 -7 Left 1137665379 16:50246324-50246346 CCCGGCCCGCCCTTCCCCGGCCT 0: 1
1: 0
2: 5
3: 89
4: 888
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665372_1137665391 21 Left 1137665372 16:50246296-50246318 CCCACACAGGCGGGCGGGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665377_1137665391 -2 Left 1137665377 16:50246319-50246341 CCTCTCCCGGCCCGCCCTTCCCC 0: 1
1: 1
2: 17
3: 182
4: 1670
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665375_1137665391 0 Left 1137665375 16:50246317-50246339 CCCCTCTCCCGGCCCGCCCTTCC 0: 1
1: 0
2: 6
3: 83
4: 907
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665376_1137665391 -1 Left 1137665376 16:50246318-50246340 CCCTCTCCCGGCCCGCCCTTCCC 0: 1
1: 0
2: 8
3: 90
4: 952
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137665391 Original CRISPR CCGGCCTCGCGGGTGCCCGG CGG Intronic
900157542 1:1209258-1209280 CCGGCCCCGGGGGTGCACAGTGG - Intergenic
900176338 1:1293047-1293069 CTGGCGTCGCGGGTGCTGGGCGG - Exonic
900366668 1:2314523-2314545 CCGGCCTCGCGGGGGAAGGGCGG + Intergenic
900379242 1:2375661-2375683 CAGCCCGCGTGGGTGCCCGGAGG + Intronic
900578251 1:3394644-3394666 CCGGCCTGGCTGATGCCCGTGGG - Intronic
901226574 1:7616558-7616580 CGGGCCTCGGGGGTGACTGGGGG + Intronic
901469256 1:9444267-9444289 CAGGCCCCGCGCCTGCCCGGAGG + Intergenic
902214208 1:14924349-14924371 CCCGCATGCCGGGTGCCCGGGGG - Intronic
903883857 1:26530071-26530093 GCGCCCTCGCGGGCGCCCGCCGG - Intronic
904688276 1:32275694-32275716 CCGGGCGCGGGGGTGCCCCGGGG + Intronic
906380091 1:45327195-45327217 CCGGGCTAGGGGCTGCCCGGCGG - Exonic
908128102 1:61050383-61050405 CCGGCGAAGCGGGTGCCGGGAGG - Intronic
910145709 1:84078005-84078027 CTGGGCGCGCGGCTGCCCGGGGG + Intergenic
910723635 1:90314754-90314776 GCTGCCTCCCAGGTGCCCGGTGG - Intergenic
910876784 1:91885801-91885823 CAGGCTGCGCGGGTGCCCGTCGG - Intronic
912451952 1:109772836-109772858 CCAGCCTCCTGGGTGCCCCGGGG + Intronic
916660763 1:166920861-166920883 CCGGCCTTGTAGGTGCCGGGCGG + Exonic
921029803 1:211327074-211327096 CCGGGCTTGCGGGAGACCGGCGG + Intronic
922753669 1:228082614-228082636 CCTGCGTCGCGGGCGCACGGTGG + Intergenic
923631197 1:235650191-235650213 CCGGCCACGCGGGCTCCGGGGGG - Intronic
924706479 1:246506899-246506921 CCTGACGCGCGTGTGCCCGGGGG - Intronic
1062890455 10:1056419-1056441 CCGGCCGCGCGGGAGCCTGGCGG - Intronic
1065188670 10:23192199-23192221 CCGGCGGCGAGGGGGCCCGGAGG - Intergenic
1066052589 10:31648995-31649017 CTGGCCTGGCGGGGGCCCTGTGG + Intergenic
1069709404 10:70479111-70479133 TCGGGCTGGGGGGTGCCCGGGGG - Intronic
1070609981 10:77926555-77926577 CCGGCCTCGGGGGGCCCGGGAGG - Intergenic
1070806612 10:79274644-79274666 CCGGCCTCGGGGGTGAGGGGTGG + Intronic
1076371569 10:129959220-129959242 CAGGCCTGGCGGGCGCCCGGGGG - Intronic
1077283831 11:1757172-1757194 CCCGCCTCCCGGATGCCCTGAGG + Intronic
1078454645 11:11465573-11465595 CAGGCCTCTCTGGTTCCCGGAGG - Intronic
1078891379 11:15561210-15561232 CAGGCCGCGCAGGAGCCCGGCGG - Intergenic
1084295736 11:68212876-68212898 CCGGCCCCGACGCTGCCCGGCGG + Intronic
1094041484 12:26125039-26125061 CCGGCGACGCGCGTGCCCTGTGG - Exonic
1096647640 12:53047338-53047360 CCGGCCGGGCGGGGGCGCGGCGG - Intronic
1103309036 12:119989727-119989749 CAGGGCTCGCGGGGACCCGGGGG + Intergenic
1103779432 12:123389198-123389220 CCGGCCGCGCGGGGGGCGGGCGG + Intronic
1103899437 12:124295610-124295632 CTGGCCTCGCTGGGTCCCGGGGG - Intronic
1104983413 12:132583672-132583694 CCGGCTCCGCGGCGGCCCGGGGG - Exonic
1113494508 13:110715920-110715942 CCGGCCCCGCGGGTCGCGGGAGG - Exonic
1115688339 14:35819802-35819824 CCGGCCTCGCGGAGACCCGAGGG - Intergenic
1117805187 14:59483922-59483944 CGGGCCTCGCGGGTGCCCGCAGG + Exonic
1117964066 14:61189146-61189168 CGGGCCTCGCGGGGGCGCTGGGG - Intronic
1121104682 14:91272665-91272687 CCGGCCTCCCCGGAGCCCGGCGG - Exonic
1121417363 14:93788569-93788591 GCGGCTGCGCGGGCGCCCGGGGG + Intergenic
1122230927 14:100306105-100306127 CTGGCCTCGCGGCTTCCCGCTGG - Intronic
1122854255 14:104552561-104552583 CAGGTCTCGCGGGTGCCCCCGGG - Intronic
1123013915 14:105364438-105364460 GCGGCGTCCCGGGTGCGCGGTGG + Intronic
1123013923 14:105364461-105364483 GCGGCGTCCCGGGTGCGCGGTGG + Intronic
1123705650 15:22949224-22949246 CCGGCCTGCCTGGTCCCCGGGGG - Intronic
1124121805 15:26894375-26894397 CCGGCCTCGCGGGCAGCCAGTGG + Intronic
1124348311 15:28937103-28937125 CAGGCCTCCCATGTGCCCGGTGG + Intronic
1127905257 15:63371542-63371564 CTGGCCTCGCGGGTGCCCTGTGG + Intronic
1128506632 15:68277675-68277697 CCGGGCCCGCGTGTGCCCGCCGG + Intergenic
1130979440 15:88803004-88803026 CAGGGCTCCCGGGCGCCCGGCGG - Intergenic
1132365284 15:101252159-101252181 CCGGCCCCGCGGGCGCCGGGCGG - Intergenic
1132591119 16:726933-726955 CCGGCGGTGCGCGTGCCCGGTGG - Intronic
1135988678 16:27203742-27203764 CCGGCCTCGCGCGTGCGCCTTGG + Intronic
1137426390 16:48384866-48384888 CCCGCCTCCCGGGCGCGCGGGGG + Intronic
1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG + Intronic
1139467129 16:67159963-67159985 CCCGCCCCGCGGGCTCCCGGTGG + Exonic
1141517272 16:84553957-84553979 CCAGCTTCGTGGGTGCCTGGAGG - Intronic
1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG + Intronic
1144756484 17:17682840-17682862 CCGGGCTGGCGGGGGCGCGGCGG + Intronic
1145939894 17:28737823-28737845 CTGGCCTCACAGGTCCCCGGGGG - Exonic
1151599034 17:75094995-75095017 CCGGCCTCGGAGGGGCCCGGTGG + Intronic
1152087953 17:78231853-78231875 CTGGCCTCGCGGGCCCCCTGGGG - Exonic
1152104159 17:78319105-78319127 CGGGCCTCGCTGGTGGCAGGCGG + Intergenic
1152345601 17:79748662-79748684 CCGGCTCCGCGGGTGCGCGAGGG - Intergenic
1152658084 17:81529231-81529253 CCGGCCTTGAGGGTGCCTGCGGG - Exonic
1153814907 18:8783707-8783729 TCGGCCTCCCGGGTGCTGGGGGG - Exonic
1154125491 18:11689246-11689268 CCGGGCTCGCGGAGGCCCGTCGG + Exonic
1160786710 19:903478-903500 CCCGCTTCCCGGGTGCCCGGTGG - Intronic
1160904307 19:1445341-1445363 CCAGGCTCGCGGGCGCCCGCTGG - Intergenic
1161067136 19:2244216-2244238 CCTGCCTCGGGAGTGACCGGCGG + Intronic
1161300294 19:3539217-3539239 CTGGCCTCGAGGGTCCCCGAGGG - Exonic
1161856227 19:6767398-6767420 CCAGCCTCGTGGGAGCCCCGCGG - Exonic
1163104084 19:15113691-15113713 CCGGCGTAGCGGTTGCTCGGGGG - Exonic
1165744827 19:38224327-38224349 CCGTCCCCGCGGGGTCCCGGGGG - Intronic
1165760741 19:38319923-38319945 CAGGGCTCGCGGGGTCCCGGTGG + Exonic
1165958368 19:39515747-39515769 CCGGCCTCGCTGGAGACCGACGG - Exonic
1166090299 19:40504029-40504051 CTGGGCTTGTGGGTGCCCGGCGG + Exonic
1167300457 19:48674615-48674637 GCGCCCCTGCGGGTGCCCGGGGG + Intergenic
1168238946 19:55079840-55079862 CCGGCCTCCAAGGTGCCGGGGGG + Exonic
928904371 2:36355468-36355490 CCGGCGCCGCGGGTGCGCTGCGG - Intergenic
931670841 2:64645267-64645289 CCGGCCGCGCGGGGGCCCGCAGG + Intronic
932623986 2:73284036-73284058 GCGGCCTCGCGGGCCTCCGGAGG + Intronic
933791732 2:85888780-85888802 TCGGCGTCGCGGGGGCCCGCGGG - Intronic
933990328 2:87629058-87629080 CCAGCCTCCCGGGTCCCAGGAGG + Intergenic
936303518 2:111321766-111321788 CCAGCCTCCCGGGTCCCAGGAGG - Intergenic
941367039 2:164621609-164621631 CCGGCCCCGCGCGTGGCCCGGGG + Exonic
943658576 2:190534490-190534512 CCGGCTTCGCGGCTGCCCTGAGG - Intronic
949040127 2:241844172-241844194 CGGGCCTCGGGGCTCCCCGGGGG - Intergenic
1171183059 20:23105145-23105167 CCGGCATCGGGAGTGCCCGTGGG + Intergenic
1172095353 20:32457581-32457603 CTGGCCTCCCGGCTGCCCGGGGG + Intronic
1172101197 20:32484500-32484522 CCGGACACTCGGGTGCCCGCGGG - Intronic
1174444051 20:50578636-50578658 AGGCCCTCGCGGGTGCCCTGGGG + Intronic
1176150935 20:63590393-63590415 CCGGCCTCCCCGCTGCTCGGGGG - Exonic
1176185358 20:63775491-63775513 CTGGCCTCTCAGGTGCACGGGGG - Intronic
1178913849 21:36696335-36696357 CCAGCCTCGCGGGCCCCAGGGGG - Intergenic
1180109645 21:45642173-45642195 CCGGCTCCGGGGGTGCTCGGGGG + Intergenic
1181574871 22:23787296-23787318 TCGGCCCCGCGGGAGCCCCGGGG + Intronic
1183264452 22:36816807-36816829 CCGACCTCGCCGGCGCCCAGCGG + Intronic
1183279297 22:36923524-36923546 CCGGCCTCGCAGGTGCCTGGCGG - Intronic
1184034111 22:41910493-41910515 CGGGCCGCGCGGGGGCCCCGGGG + Exonic
1184476802 22:44726527-44726549 CCGCCCTTGTGGATGCCCGGGGG - Intronic
955486410 3:59438925-59438947 CCGGCCTGCTGGGTGCCAGGTGG + Intergenic
961551504 3:127672722-127672744 CCGGCCCCGCGGGCGGCGGGCGG + Exonic
968572142 4:1347396-1347418 CCGGCTTCGACGGTGCTCGGGGG - Exonic
969691581 4:8706909-8706931 CCAGCCCCGCCGGGGCCCGGGGG + Intergenic
970523564 4:16909413-16909435 CCAGCCTCCAGGGTGTCCGGAGG - Intergenic
973230813 4:47837410-47837432 CCGGCGTCTCGGGCGCCGGGTGG - Intronic
978327391 4:107575013-107575035 CAGGCGTCGCTGGTGCCCGTTGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
985749842 5:1667636-1667658 CCGCCCACGAGGCTGCCCGGAGG - Intergenic
1000296397 5:159916613-159916635 CCGGGCTCGCGGGGGAGCGGCGG - Intergenic
1001773416 5:174312021-174312043 CCGGGCGCGCGGGGGCGCGGGGG + Intergenic
1002065504 5:176649768-176649790 CCGGCCCCGCGGGGCCCTGGAGG - Intronic
1004272904 6:14211176-14211198 CCGGCCGAGCGGGAGCCCGCGGG - Intergenic
1005048499 6:21664361-21664383 CCTGCCTCGCGGCTGCTCGCTGG + Intergenic
1005288998 6:24360002-24360024 CCGGCCGCGCGGGGGCGGGGCGG + Intergenic
1005385298 6:25279455-25279477 CCCGGCTCGCTGGTCCCCGGCGG - Exonic
1006788619 6:36684337-36684359 CCGGCCTCGCCGGGGCCCCGTGG - Exonic
1014741674 6:125154263-125154285 CCAACCTCGCGGCTGCCCGAAGG + Intronic
1018017813 6:159727606-159727628 CCGGCTGCGCGGTGGCCCGGGGG + Intronic
1019276202 7:177290-177312 CAGGCCTCGGCGGTGCCCTGGGG - Intergenic
1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG + Exonic
1020046802 7:5046350-5046372 CCGGCCTCTCGGGAGCCGTGGGG + Exonic
1022113057 7:27243190-27243212 CCGCGCTCCCGGGTGGCCGGAGG - Exonic
1022113060 7:27243193-27243215 CCGGCCACCCGGGAGCGCGGCGG + Exonic
1025020526 7:55476335-55476357 CCAGCCCCACGGGTGCCAGGGGG + Intronic
1026727352 7:72879839-72879861 CCGGCCTCTCGGGAGCCGTGGGG + Exonic
1027116504 7:75485888-75485910 CCGGCCTCTCGGGAGCCGTGGGG - Exonic
1027121794 7:75527589-75527611 CCGGCCTCTCGGGAGCCGGGGGG - Intergenic
1029721033 7:102364365-102364387 CCGGCCTCTCGGGAGCCGTGGGG + Exonic
1030820742 7:114087700-114087722 GCGGCCTCGCGGGTGGGCAGAGG - Intronic
1034898487 7:154892715-154892737 CCGGTCTCTCGGGCGCCGGGAGG - Exonic
1036926208 8:12908762-12908784 CCAGCCTCGCGGGTACCTGGGGG - Intergenic
1039885110 8:41650064-41650086 GGGGCCTGGCGGGTGCCGGGAGG + Intronic
1040579850 8:48688979-48689001 CTGGCCTCGCTGGTGACCGCAGG - Intergenic
1045222586 8:100213288-100213310 CCCGCCGCCCGGATGCCCGGTGG - Exonic
1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG + Intronic
1048981108 8:139703737-139703759 CCGGGCGCGCGGGTGCGCAGCGG + Intergenic
1049746875 8:144266753-144266775 GCGGCCTCCAGGGCGCCCGGCGG + Exonic
1053161257 9:35814903-35814925 GCGGCCACGGGGGTGCGCGGGGG - Exonic
1053345928 9:37378209-37378231 AGGGCCTCCCGGGTGGCCGGTGG - Intergenic
1053835337 9:42129315-42129337 TCGGCCCCGCGGGAGCCTGGGGG + Exonic
1057490299 9:95515643-95515665 GCGGCCTCAGGGGAGCCCGGGGG - Intronic
1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG + Exonic
1061056655 9:128226258-128226280 CCGGCCTCACGGCTACCCGCAGG + Intronic
1062428131 9:136515456-136515478 CCGGCCAGGCGGGTGGCCGGCGG - Intronic
1062549349 9:137078750-137078772 CCGGGTTCGCGGCTGCCCCGAGG + Intronic
1062556086 9:137114065-137114087 CGGGGCACGCGGGTGCCGGGCGG - Intronic
1062556103 9:137114106-137114128 CGGGGCACGCGGGTGCCGGGCGG - Intronic
1062556120 9:137114147-137114169 CGGGGCACGCGGGTGCCGGGCGG - Intronic
1062590538 9:137272608-137272630 CAGGCCAGGTGGGTGCCCGGGGG + Exonic
1186349976 X:8731366-8731388 CCAGCCCCGCAGGTGCCCGCGGG - Intronic
1194044253 X:88982431-88982453 CCTGCCTCGCGGCTGGTCGGGGG - Intergenic
1196400555 X:115311924-115311946 CCTGCCTCGCGGGTCGCCTGGGG - Intergenic
1198489303 X:137122831-137122853 CCAGCCTCGCTGGTGCCTTGTGG - Intergenic
1198534645 X:137574337-137574359 CGGCCCGCGCGGGTGCCCAGGGG + Intronic
1199772783 X:150984542-150984564 CCGGCCCCGCGCGTCCCCCGGGG + Intronic
1202109396 Y:21405372-21405394 CTGGCCTCCCGTGTGCCCAGGGG - Intergenic