ID: 1137665391

View in Genome Browser
Species Human (GRCh38)
Location 16:50246340-50246362
Sequence CCGGCCTCGCGGGTGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137665373_1137665391 20 Left 1137665373 16:50246297-50246319 CCACACAGGCGGGCGGGTGGCCC 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665375_1137665391 0 Left 1137665375 16:50246317-50246339 CCCCTCTCCCGGCCCGCCCTTCC 0: 1
1: 0
2: 6
3: 83
4: 907
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665376_1137665391 -1 Left 1137665376 16:50246318-50246340 CCCTCTCCCGGCCCGCCCTTCCC 0: 1
1: 0
2: 8
3: 90
4: 952
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665379_1137665391 -7 Left 1137665379 16:50246324-50246346 CCCGGCCCGCCCTTCCCCGGCCT 0: 1
1: 0
2: 5
3: 89
4: 888
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665372_1137665391 21 Left 1137665372 16:50246296-50246318 CCCACACAGGCGGGCGGGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665371_1137665391 22 Left 1137665371 16:50246295-50246317 CCCCACACAGGCGGGCGGGTGGC 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665377_1137665391 -2 Left 1137665377 16:50246319-50246341 CCTCTCCCGGCCCGCCCTTCCCC 0: 1
1: 1
2: 17
3: 182
4: 1670
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145
1137665380_1137665391 -8 Left 1137665380 16:50246325-50246347 CCGGCCCGCCCTTCCCCGGCCTC 0: 1
1: 0
2: 6
3: 145
4: 1041
Right 1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG 0: 1
1: 0
2: 3
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137665391 Original CRISPR CCGGCCTCGCGGGTGCCCGG CGG Intronic