ID: 1137667078

View in Genome Browser
Species Human (GRCh38)
Location 16:50257261-50257283
Sequence ACTCAGAAGCAGCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137667074_1137667078 1 Left 1137667074 16:50257237-50257259 CCACCAACAAAAAAATCCAATTG 0: 1
1: 0
2: 2
3: 35
4: 477
Right 1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG 0: 1
1: 0
2: 2
3: 28
4: 309
1137667073_1137667078 4 Left 1137667073 16:50257234-50257256 CCACCACCAACAAAAAAATCCAA 0: 1
1: 2
2: 38
3: 208
4: 1826
Right 1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG 0: 1
1: 0
2: 2
3: 28
4: 309
1137667075_1137667078 -2 Left 1137667075 16:50257240-50257262 CCAACAAAAAAATCCAATTGAAC 0: 1
1: 0
2: 5
3: 31
4: 428
Right 1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG 0: 1
1: 0
2: 2
3: 28
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137667078 Original CRISPR ACTCAGAAGCAGCAAGTGGA AGG Intronic
902666381 1:17941848-17941870 ACTCAGAAGGAGAAAGTTAAAGG + Intergenic
903206542 1:21786580-21786602 ACTCAGAAGGCTGAAGTGGAGGG + Intergenic
903274182 1:22210400-22210422 AGTCAGAAGCAGCAACAGAAGGG - Intergenic
905319379 1:37105122-37105144 CCTCAGTAGCAGCAGGTGGCAGG - Intergenic
906741607 1:48190333-48190355 ACTCATAAAAAGCAAGTAGATGG + Intergenic
907957840 1:59247943-59247965 ACTGAGAAGCAGCAAGCTCATGG - Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
909770168 1:79412236-79412258 ATTAAGAAGAAGCAAGTGCAAGG - Intergenic
910395809 1:86792822-86792844 TCTCAGCAGCTGCCAGTGGATGG + Intergenic
910443524 1:87277540-87277562 ATTCAGATTCAGCAAGTGGTTGG + Intergenic
911117786 1:94264536-94264558 GCCCAAAAGAAGCAAGTGGAAGG - Intronic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
917345208 1:174022254-174022276 CCTCAGCAGCAGCAGGTGGGAGG - Exonic
917527797 1:175804447-175804469 ACTCAGAAGCATGAGGTGGGAGG + Intergenic
917615593 1:176740734-176740756 TCTCAGCAGCAGCTATTGGAGGG + Intronic
917948021 1:179997041-179997063 ACTCAGAAGAAACAAATGGCCGG + Exonic
921533250 1:216311443-216311465 AATGAGAAACACCAAGTGGATGG - Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922762739 1:228142667-228142689 CCTCGCAAGCAGCAAGTGGCAGG - Intronic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
1063957618 10:11281304-11281326 CCTCAGAAGCACCAAGTTCAGGG + Intronic
1066021498 10:31308184-31308206 ACTCAGAGGCAAGAAATGGAGGG + Intergenic
1066580271 10:36872927-36872949 ACTAAGAAGCACTAAGTGAAAGG - Intergenic
1067729863 10:48802844-48802866 ACTCACCACCAGCAAGTGGCAGG - Intronic
1068590392 10:58846940-58846962 ACTGAGAGTCAGGAAGTGGAAGG + Intergenic
1069104506 10:64366281-64366303 AATCAGAAGCAGTAAGTCCAGGG + Intergenic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069574518 10:69517181-69517203 ACACAGGAGCAGCGAGAGGAAGG - Intergenic
1071289500 10:84177890-84177912 GCTCAGAGGCAGGAAGTTGAGGG + Intronic
1071555368 10:86597437-86597459 CCTCAGCAGCTGCACGTGGAAGG - Intergenic
1072842514 10:98790338-98790360 ACTCAGAAGGTGGAACTGGAGGG + Intronic
1073517346 10:104088434-104088456 GCTCAAAAGCATCAAGTGAAGGG + Intergenic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1076584655 10:131537286-131537308 ACTCAGAAGTAGGGAGTAGAAGG - Intergenic
1077549502 11:3193778-3193800 TCTCAGAAGCAGAAAGTCCAGGG + Intergenic
1077770249 11:5210440-5210462 ATCCAGAATGAGCAAGTGGATGG + Intergenic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079414500 11:20221017-20221039 ACTAGGAATCAGCAAGTGGAAGG + Intergenic
1079588824 11:22157684-22157706 CCTCAGAAGGAGCATCTGGAAGG + Intergenic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1081436052 11:43028473-43028495 AGACTGAAGAAGCAAGTGGAAGG - Intergenic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1086251278 11:84817592-84817614 ACTCATAAGCTGCAGGTGGCTGG - Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088637124 11:111832921-111832943 ACTCAGGAGCTTGAAGTGGAAGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089069904 11:115691533-115691555 ACTCAGAAGCACAGAGTAGAAGG + Intergenic
1089910340 11:122092677-122092699 ACTCAAATGAATCAAGTGGAAGG + Intergenic
1090373368 11:126272260-126272282 ACCCAAAAGAAGCAAGTTGAGGG - Intronic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1092885232 12:12918959-12918981 TCTCAGAAGCTGCACGGGGAGGG - Intergenic
1093666105 12:21815072-21815094 ACTCAGAAGGCTCAAGTGGGAGG + Intronic
1093740032 12:22675175-22675197 ACTCAGAAGGCTCAAGTGGGAGG - Intronic
1095535344 12:43239678-43239700 ACACAGAAGCAGCAAGAACATGG - Intergenic
1095761301 12:45840099-45840121 ACTCATAATGAGCCAGTGGAAGG - Intronic
1096256114 12:50063333-50063355 GCTGAGCAGCAGCAAGGGGAGGG + Intronic
1097261251 12:57721396-57721418 ACTCAGAAGCACAAATTGTAGGG - Exonic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098081605 12:66791828-66791850 ACTCAGAAGCAGGGAGGGTAAGG - Intronic
1101408750 12:104452417-104452439 ACTGAGGAGCAGCAAGAGGCAGG + Intergenic
1101445148 12:104732136-104732158 GCTCAGAAGCAGGAGGTGGCAGG + Intronic
1102062491 12:109944061-109944083 ACTCAGAAGCCTGAAGTGGGAGG + Intronic
1102653906 12:114463810-114463832 ATCCAGAAGAATCAAGTGGAGGG - Intergenic
1102824518 12:115936805-115936827 ACTTAGAATCAGCAGGTGAAGGG + Intergenic
1103152932 12:118657162-118657184 ACTCAGAAGCTGCAAAAGCAAGG + Intergenic
1103567779 12:121825482-121825504 ACACAGAGGGTGCAAGTGGAAGG + Intronic
1104738261 12:131153312-131153334 AGTCAGAAGCAACCAGTGCATGG - Intergenic
1106591378 13:31101654-31101676 TCTCTGAAGCAGCAAGTGTCTGG + Intergenic
1107516887 13:41138091-41138113 ACTCACAATCAGAAAGTTGAGGG - Intergenic
1108215295 13:48177770-48177792 ACTCAGGAGCCTGAAGTGGAAGG + Intergenic
1111396546 13:87674083-87674105 GATCAGAAGTAGGAAGTGGAAGG + Intronic
1111992690 13:95132870-95132892 ACTCAGAGACAGAAAGTAGAAGG + Intronic
1112422712 13:99267613-99267635 AAGCAGCAGTAGCAAGTGGAAGG - Intronic
1112821561 13:103343550-103343572 ACTCAAAAACAGCAAAAGGAGGG - Intergenic
1114132944 14:19814437-19814459 ACTCAGTAGCAGGATGTTGACGG - Intronic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115523482 14:34256272-34256294 ACTCAGAAGGCTGAAGTGGAGGG - Intronic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116815745 14:49581911-49581933 ACTCAGAAGGCTGAAGTGGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117248988 14:53916362-53916384 ACTCAGAAGGCTGAAGTGGAAGG + Intergenic
1119684902 14:76623727-76623749 GCTCAGAAGAAGCAGGTAGATGG - Intergenic
1121468010 14:94128359-94128381 ACTCAGAAGGAGCCAGAAGAGGG + Intronic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122841619 14:104467298-104467320 ACTCAGAACCAGCGAATGAAGGG - Intergenic
1124017482 15:25889618-25889640 ACTCAAAAGCAGTAAATTGAAGG - Intergenic
1124552718 15:30696415-30696437 ACTCAGAAGCAGAGAGCTGAGGG - Intronic
1124678524 15:31709255-31709277 ACTCAGAAGCAGAGAGCTGAGGG + Intronic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1128359653 15:66953102-66953124 GCTCAGAAGCAGCCTGGGGATGG - Intergenic
1129056578 15:72824497-72824519 TCTCAGCAGAGGCAAGTGGAGGG + Intergenic
1130090925 15:80820596-80820618 ACTGAGAATCAGAAAGTTGAGGG - Intronic
1130117955 15:81021980-81022002 ACTCAGAAGGATGAAGTGGGAGG - Intronic
1130241338 15:82195717-82195739 GCTCAGAAGCAGCACCTGGGAGG + Intronic
1130641312 15:85678287-85678309 ACTTAGAATCAGCAAGTGGTAGG - Intronic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1132240052 15:100250759-100250781 TCTCAGAACCAGGAAATGGACGG - Intronic
1133516323 16:6512760-6512782 AGTCAGCAGGAGCAAGAGGATGG + Intronic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1134796673 16:17044994-17045016 ACTCAGAAGCAAAGAGTAGAAGG - Intergenic
1135414188 16:22256676-22256698 TCTGAGAAGCGGCAAGGGGAGGG - Intronic
1135845262 16:25912939-25912961 AATCAGAATCACAAAGTGGAGGG + Intronic
1137540573 16:49358925-49358947 ACTCAGACTCAGGGAGTGGAGGG + Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137849556 16:51725805-51725827 AATCACAAGCAACAAATGGAAGG + Intergenic
1138240023 16:55419895-55419917 CACCAGAAGCAGCAAGTGCAAGG - Intronic
1139092336 16:63663318-63663340 ACTAAGATGCAGCAAGTAAAGGG - Intergenic
1142395784 16:89830462-89830484 ACTCAGAAGCACCACAAGGATGG - Intronic
1142492203 17:286404-286426 ACACTGAAGCAGCAGGGGGATGG - Intronic
1143042534 17:4049401-4049423 ACTCAGAAGGATGAAGTGGGAGG + Intronic
1143880553 17:10026520-10026542 ACCCAGAAGCAGCCAGGGCATGG + Intronic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1146615937 17:34357489-34357511 AATGTGAAGCAGCAAGTAGATGG - Exonic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1148626585 17:49074012-49074034 ACTCAGGAGCACCAATGGGATGG - Intergenic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151257672 17:72891505-72891527 ACTGGGGAGCAGCAAGTGGGAGG - Intronic
1153730545 18:8007093-8007115 ATTCAGAATCAGCAAGTGAGAGG - Intronic
1155344941 18:24848658-24848680 ACTCAAAAGCCCCAAGAGGATGG - Intergenic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1157278660 18:46331258-46331280 AATCATAAATAGCAAGTGGAGGG + Intronic
1157917977 18:51688115-51688137 ACACAGACCCAGCAACTGGAAGG - Intergenic
1159171214 18:64769872-64769894 TCTCAGAAAAAGCAAGTGTATGG - Intergenic
1159480893 18:68989931-68989953 ACTCAAAAGGACCAACTGGATGG - Intronic
1159548721 18:69872613-69872635 ACTGAGAAGAAGGAATTGGAGGG - Intronic
1159619399 18:70620064-70620086 GCTAAGAAGGACCAAGTGGATGG - Intergenic
1159679800 18:71334991-71335013 ACACAGAAGGAGTAGGTGGAGGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160354512 18:78215808-78215830 ACCTTGAAGCTGCAAGTGGAGGG + Intergenic
1160717291 19:582139-582161 ACTCAGAAGATGCACGTGGCCGG + Intronic
1161208769 19:3055816-3055838 TCTTAGAAGCCGCAAGTGGCAGG - Intronic
1163397760 19:17074202-17074224 ACACAGGAGGGGCAAGTGGATGG + Intronic
1164645212 19:29854295-29854317 ACTCAGAAGGAGGAAGAGGGTGG + Intergenic
1164708204 19:30335860-30335882 ACCAAGAACCAGCAGGTGGATGG + Intronic
1164872394 19:31656838-31656860 ACTCACAAGCATTGAGTGGAAGG + Intergenic
1165334631 19:35160726-35160748 ACCCAGACCCAGCAACTGGAAGG + Exonic
1165470057 19:35998081-35998103 ACTCAGAAGGCTGAAGTGGAAGG - Intergenic
1166582256 19:43912107-43912129 TCTCAGAAGCATTAAGTGAAAGG + Intergenic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168348992 19:55665212-55665234 ACTAAGCACCAGCAAGTGGCGGG - Intronic
1168379001 19:55904434-55904456 ACTCAGATGAAGCAAGGGGGAGG - Intronic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
926028999 2:9569269-9569291 ACTCAAAAGGAGCAGCTGGAAGG + Intergenic
927411163 2:22828032-22828054 CTTCACAAGCAGCAAATGGAAGG + Intergenic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
927948139 2:27149626-27149648 ACTGAGCAGCAGCCAGTGGTAGG + Intronic
928163866 2:28955224-28955246 CCTAAGAATCAGCAAGTGGCTGG - Intergenic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928689544 2:33785034-33785056 ACTCAGAAGCAACAAGTAAGTGG - Intergenic
929799740 2:45089403-45089425 ACTGAGACTCAGCAAGTGTAAGG + Intergenic
935413127 2:102786854-102786876 ACTCACAATCAGGAAGTGGAGGG + Intronic
935817444 2:106859977-106859999 ACTCAGGGGCAGCAAGGGGTCGG - Intronic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939116085 2:138062418-138062440 CCACAGGAGCAGTAAGTGGAAGG + Intergenic
939643491 2:144668666-144668688 ACACAGAATGAGGAAGTGGAGGG + Intergenic
940253730 2:151707594-151707616 TGGCAGAAGCAGCAAGTTGAGGG + Intronic
940751808 2:157634390-157634412 ACTCAGTAGCCACAAGTGGCTGG - Intergenic
942352014 2:175062814-175062836 ACTCAGCAGCAGGAAGTGGGGGG + Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944441547 2:199748726-199748748 AGTCAAAAGGATCAAGTGGAGGG + Intergenic
946057151 2:216912330-216912352 ACTCAGCATCAGCACCTGGAGGG + Intergenic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
946476484 2:220011285-220011307 ACTCACAATCAGAAAGGGGAGGG - Intergenic
946693094 2:222324530-222324552 ACTCAGAAGCAGGTACTAGATGG + Intergenic
946703160 2:222432690-222432712 ACTCAGAAGCCAGAGGTGGAGGG + Intronic
1168866239 20:1089506-1089528 AATTAGAAGAAGCTAGTGGAAGG + Intergenic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1174064345 20:47853719-47853741 TCTCAGAAGCAGGAACTGGGGGG + Intergenic
1176268990 20:64225665-64225687 ACTCAGAAGCAGGTGGTGGGAGG + Intronic
1177306059 21:19317408-19317430 ACACAGAAGCTGCCAGTGGTTGG + Intergenic
1177760645 21:25399303-25399325 CTCCAGCAGCAGCAAGTGGAGGG + Intergenic
1177836427 21:26190561-26190583 ACTCAGAAGGCTGAAGTGGAAGG - Intergenic
1178520918 21:33287963-33287985 TCTCAGAAACAGCAACTGGTTGG - Intronic
1178987262 21:37317167-37317189 ACTCAGGAGGATGAAGTGGAAGG + Intergenic
1179179522 21:39033911-39033933 ACTCAGAAGAAGAAAGTGTGGGG + Intergenic
1179468097 21:41591434-41591456 GCTCATAGGAAGCAAGTGGATGG - Intergenic
1179496317 21:41773567-41773589 CCACAGAGGCAGCAAGTAGATGG + Intergenic
1179563626 21:42232855-42232877 ACTCAGAAAGAGCAGGTGTATGG - Intronic
1181600900 22:23951407-23951429 ACACAGAAGCAGTCTGTGGAGGG + Intergenic
1181607613 22:23989919-23989941 ACACAGAAGCAGTCTGTGGAGGG - Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181947645 22:26530645-26530667 AATCAGCAGGAGCAGGTGGAAGG + Intronic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182132858 22:27870829-27870851 CCTCCACAGCAGCAAGTGGATGG + Intronic
1182681088 22:32080475-32080497 CCTCAGGAGCAGCAATGGGATGG + Intronic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1183027043 22:35073026-35073048 ACACTCAAGCAGCATGTGGAGGG - Intronic
1185403753 22:50633182-50633204 AATCAAAAGCTGCCAGTGGAGGG - Intergenic
950867474 3:16200674-16200696 ACTCAGGAGCAACAAGAGGCTGG + Exonic
952953650 3:38543519-38543541 TCTCAGAAGCAGCCAGGGGCAGG + Intergenic
954485682 3:50849141-50849163 TCTCAGAAGCCTAAAGTGGAGGG - Intronic
955790074 3:62579885-62579907 AGGCAGGAGCAGCAAGTGAAGGG + Intronic
956171582 3:66437643-66437665 ACTCTGAGGGACCAAGTGGAAGG - Intronic
956225379 3:66951668-66951690 TCTTAGAAACAGCAAATGGAAGG + Intergenic
956816682 3:72914413-72914435 ACTCAGAATCAGGAAGTAGTGGG + Intronic
957938010 3:86968911-86968933 ACTCAGACACAGCAGGGGGAGGG + Exonic
959369781 3:105508905-105508927 ACACAGAAACAGAGAGTGGATGG - Intronic
959971765 3:112417533-112417555 AGACATAAGCAGCAAGAGGAGGG + Intergenic
960402343 3:117217159-117217181 GCTCAGAAGCCTCATGTGGACGG + Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
961465699 3:127079826-127079848 ACGGAGAAACAGCAAGTGCAAGG - Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964502034 3:157358532-157358554 CCCCAGAAGCATTAAGTGGATGG + Intronic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966891287 3:184409390-184409412 ACGCAGACACTGCAAGTGGACGG + Intronic
967563553 3:190946320-190946342 ATTCAAAAGCAGCAAATAGAAGG + Intergenic
967687641 3:192436366-192436388 ACACAGCAGAATCAAGTGGAGGG + Intronic
969247928 4:5947659-5947681 CCTCAGAGGCAGCAAAAGGAAGG - Intronic
970604403 4:17665899-17665921 ACTAAGAAGCAGCAACTGGGGGG - Intronic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
972010061 4:34167874-34167896 ACTCACAAGAAACATGTGGAAGG + Intergenic
972195818 4:36652736-36652758 ATTCAAAAGCAGCAGGTGTATGG - Intergenic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
975600326 4:76093119-76093141 AGTCAGAAACAGCATGTTGATGG + Intronic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
977329926 4:95624635-95624657 ACACAGTCTCAGCAAGTGGAAGG - Intergenic
978283480 4:107045534-107045556 ACTCAAACCCAGGAAGTGGAGGG + Intronic
978670115 4:111237747-111237769 AGTCAGTAGCAGCAAATTGAGGG - Intergenic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
979528345 4:121741128-121741150 AGAAAGCAGCAGCAAGTGGAGGG - Intergenic
979947402 4:126850454-126850476 AGTCATGAGCAGGAAGTGGAAGG - Intergenic
981838144 4:149079403-149079425 ACACAGATGGAGCAAGAGGAAGG - Intergenic
981897631 4:149822286-149822308 ACTCAGGAGGATGAAGTGGAAGG - Intergenic
982329480 4:154165260-154165282 ACTCAGCAGCAGCATGGGAAAGG - Intergenic
983458600 4:167997566-167997588 TCTCTGAAGCAGCAAGCGAATGG + Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
984607825 4:181805295-181805317 AGTCCCAAGCAGCACGTGGACGG - Intergenic
984638838 4:182142601-182142623 GCTCTGAAGCTGAAAGTGGAGGG + Intergenic
984830100 4:183964931-183964953 CCTCAGAAACAGGAAATGGAAGG + Intronic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986349021 5:6859715-6859737 ACACAGAGGCAGAAATTGGAGGG - Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
987807215 5:22784642-22784664 AGTAAGAAGAAGCAAGTAGAGGG - Intronic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
988994988 5:36706239-36706261 AATCAGAAGAGGCAATTGGAAGG - Intergenic
990007257 5:50958110-50958132 ACTCAGCAGCAGCAGCGGGAAGG - Intergenic
993120464 5:83768060-83768082 AATCAGAAGCTGTATGTGGAGGG - Intergenic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994573584 5:101546245-101546267 ACTCAGAAGCATGAAGTGAGAGG - Intergenic
995215701 5:109591966-109591988 AATCAGGAGCTGCAAGCGGAAGG + Intergenic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996882509 5:128315857-128315879 CTTCAGAATCAGCAAGTGAAAGG - Intronic
998425644 5:142026038-142026060 ACTAAAAGGCAGCAAGCGGAGGG + Intergenic
998955656 5:147435697-147435719 ACTTAGAAACAGCAAGTGGCAGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999430260 5:151519830-151519852 ATTCTGAAGCAGCAGGTGCAAGG - Intronic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
999680964 5:154059692-154059714 AATCAGAAGCAGTAAGTGCTAGG + Intronic
1001934844 5:175696628-175696650 GGTCAGCAGCAGGAAGTGGATGG + Intergenic
1002178130 5:177414070-177414092 CCTAAGAAGGAGCTAGTGGAAGG - Intronic
1002473243 5:179450086-179450108 AGGCAGAAGGAGCAAGGGGAGGG + Intergenic
1002480978 5:179500567-179500589 AGGCAGAAGGAGCAAGGGGAGGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1004440965 6:15653472-15653494 ATTTAAAAGCAGCAAGTAGAGGG - Intronic
1006299030 6:33184133-33184155 ACTCAGGAGCCGTAAGTGAAAGG - Intronic
1008200921 6:48589149-48589171 ACTCAGAAGGACAAAGAGGAAGG + Intergenic
1008683703 6:53901429-53901451 ACTCAGAAGCCTGAAGGGGAAGG + Intronic
1008977316 6:57442962-57442984 ACTCAGAAGCAGAGAATAGAAGG - Intronic
1009165452 6:60335913-60335935 ACTCAGAAGCAGAGAATAGAAGG - Intergenic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1012908153 6:105091220-105091242 TCTCTGAGGCAGCCAGTGGATGG - Intergenic
1013962635 6:115918788-115918810 ACACAGAAGCAACAGATGGAAGG + Intergenic
1015521378 6:134134999-134135021 CCTCAGAAGCTGCAAGTAGAGGG + Intergenic
1017984404 6:159430684-159430706 ACTTAGAAGCAACTGGTGGAGGG - Intergenic
1020878927 7:13734574-13734596 AATCAGAAGCAGTTACTGGAGGG - Intergenic
1023071740 7:36441573-36441595 ACTGAGGAGCAGCAAGAGGCAGG + Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024584788 7:50832697-50832719 ACTCAGAAGCAGACAGGGCATGG + Intergenic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1032356911 7:131219750-131219772 AATCAGACACAGCCAGTGGAGGG - Intronic
1033527528 7:142231391-142231413 ACTCAGAAGTAGCAAGCTGCTGG - Intergenic
1034205577 7:149311769-149311791 ACTCAGAAGCCTGAAGTGGGAGG - Intergenic
1035105564 7:156439588-156439610 GCTCAGACGGAGTAAGTGGATGG - Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035366259 7:158350795-158350817 ACCCAGAAGGAGCAAGTAGCTGG + Intronic
1037525547 8:19720692-19720714 TCTGAGAACAAGCAAGTGGATGG - Intronic
1039895902 8:41716355-41716377 ATTCAGAAACAGGAAGTGGGGGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041040704 8:53843333-53843355 ACTCCAAAGCAGCAAGAGGAGGG + Intronic
1041044526 8:53878469-53878491 TCTCCTAAGCAACAAGTGGAAGG + Intronic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1043619005 8:82164713-82164735 TCTCTGAAACAGCAAGTGAAAGG - Intergenic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1046304448 8:112345539-112345561 ACTCAGGAGTAGAAAGTAGAAGG + Intronic
1048852393 8:138657596-138657618 ACACAGGACCAGCATGTGGATGG + Intronic
1049757462 8:144317063-144317085 ACGGGGCAGCAGCAAGTGGATGG - Exonic
1050651248 9:7779154-7779176 ACTCAGAGGGTGGAAGTGGAGGG + Intergenic
1050965770 9:11800065-11800087 ACTCAGAAACAGAAAGTCCAAGG - Intergenic
1051339624 9:16099586-16099608 TCTGAGAAGCAGCTTGTGGAAGG + Intergenic
1053416406 9:37949590-37949612 GGACAGAAGCAGCAAGGGGAAGG + Intronic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1058642432 9:107100524-107100546 CCACAGGAGCAGCCAGTGGAAGG - Intergenic
1058931686 9:109726324-109726346 TTTCAGAAGCAGCAATTGCAGGG + Intronic
1059195207 9:112364978-112365000 ACGTAGAAGCAGCAAATAGAAGG - Intergenic
1059506897 9:114807364-114807386 AACCAGAAGTAGCAACTGGATGG - Intergenic
1062511799 9:136910294-136910316 TCTCATAAGCAGCACATGGAGGG - Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1187960354 X:24561907-24561929 ACGCAGAAGTAGCAGGTTGAGGG + Exonic
1188372224 X:29382736-29382758 ACACAGAGGCATCCAGTGGAAGG - Intronic
1188691977 X:33140532-33140554 ACTGAGAATCAGAAAATGGAGGG - Intronic
1189330901 X:40144650-40144672 ACTCTGAAGAACAAAGTGGAGGG - Intronic
1189364212 X:40375707-40375729 ATCCAGGTGCAGCAAGTGGAGGG + Intergenic
1189777689 X:44484877-44484899 GCTTAGGAGCAGCTAGTGGAGGG - Intergenic
1190283161 X:48944597-48944619 ACTCAGACCCAGCAAGTGCCTGG + Intronic
1190528955 X:51355676-51355698 CCTCAGAACCAGGAAGTAGATGG + Intergenic
1191882834 X:65859733-65859755 ACTCAGGAGCAGTAAGAGGGAGG - Intergenic
1192956535 X:76076386-76076408 ACTCAGAAGCAGCAGAGGAAAGG - Intergenic
1193331205 X:80237468-80237490 ACTCAAAAAAAGCAAGTGGGTGG + Intergenic
1194850756 X:98865616-98865638 ACTCAGAAGCAACAAATAGATGG + Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1196826590 X:119745490-119745512 ACTCAGAAGGCTCAAGTGGGAGG - Intergenic
1197408329 X:126083827-126083849 ACTCAGAAGCAGCAGCTCGGAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic