ID: 1137667880

View in Genome Browser
Species Human (GRCh38)
Location 16:50262233-50262255
Sequence CTGAGGAGAAGTACCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137667880_1137667886 29 Left 1137667880 16:50262233-50262255 CCCTGCTGGGTACTTCTCCTCAG 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1137667886 16:50262285-50262307 TCTCACTTTGTCACCCAGGCTGG 0: 2252
1: 37171
2: 90596
3: 175079
4: 186797
1137667880_1137667885 25 Left 1137667880 16:50262233-50262255 CCCTGCTGGGTACTTCTCCTCAG 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1137667885 16:50262281-50262303 AGGGTCTCACTTTGTCACCCAGG 0: 899
1: 9371
2: 31984
3: 81506
4: 150764
1137667880_1137667883 5 Left 1137667880 16:50262233-50262255 CCCTGCTGGGTACTTCTCCTCAG 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1137667883 16:50262261-50262283 TTTTTTTTTTTTTTTGAGACAGG 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
1137667880_1137667884 6 Left 1137667880 16:50262233-50262255 CCCTGCTGGGTACTTCTCCTCAG 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1137667884 16:50262262-50262284 TTTTTTTTTTTTTTGAGACAGGG 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137667880 Original CRISPR CTGAGGAGAAGTACCCAGCA GGG (reversed) Intronic
900158459 1:1212669-1212691 CTGGGGAGAAGTGCCCTGGAGGG + Exonic
900537821 1:3187483-3187505 CTCTGGAGAAGTCCCCAGCCAGG + Intronic
901188635 1:7390494-7390516 CTCAGGAGTAGTAAGCAGCAGGG - Intronic
903072481 1:20733092-20733114 CTGAGGAGGAGTGGCCAGCATGG - Intergenic
904013985 1:27406405-27406427 CAGAGGAGAAGCGGCCAGCAAGG + Exonic
905092275 1:35439083-35439105 CTCAAGAGAAGTCCTCAGCAGGG + Intronic
906072824 1:43029532-43029554 CTGAGGAGAAGTCCTCACCAAGG + Intergenic
906535787 1:46550342-46550364 CTGAGGACAAGCACCCAGTCCGG - Intronic
910652460 1:89584157-89584179 TTGAGGTGAAATACCCAGCGTGG - Exonic
912248174 1:107983053-107983075 CTGATGAGAAGTAGACAGCGTGG - Intergenic
912392518 1:109314015-109314037 CAGAGGAGCTGGACCCAGCATGG - Exonic
912560135 1:110545321-110545343 CTGAGAAGGAGTAGCCAGCACGG - Intergenic
913111342 1:115659995-115660017 GTGTGGAAAAGTAGCCAGCAAGG + Intronic
914238217 1:145831707-145831729 CTGAGGAAAGGTAGCCAGAAAGG + Intronic
915746947 1:158168858-158168880 CTTATGACAAGTAACCAGCAGGG + Intergenic
916485288 1:165253448-165253470 CTAAGGAGAAGTTCCCAGGGAGG + Intronic
917684224 1:177399833-177399855 CTGATGGGAAGCTCCCAGCAGGG - Intergenic
917904785 1:179577726-179577748 CTGAGAACAAGTGCTCAGCATGG - Intergenic
918177409 1:182058041-182058063 CTGAGGAGGAGTATCCTGCTTGG + Exonic
918636468 1:186780527-186780549 CTGAGTAGAGAAACCCAGCAAGG - Intergenic
920082073 1:203382185-203382207 AGGAGGAGATGTACACAGCAGGG - Intergenic
920920467 1:210293569-210293591 CTCAGGAGCAGGACCCAGGAGGG - Intergenic
921669248 1:217908137-217908159 CAGGGAAGAAGTTCCCAGCAGGG + Intergenic
1063457185 10:6192190-6192212 CTGAGGAGGAGTACACAGAAGGG + Intronic
1064251157 10:13707464-13707486 CCGGGGAGAGGGACCCAGCAGGG + Intronic
1065420826 10:25542380-25542402 ATGATGAGAAGAAGCCAGCATGG - Intronic
1065518086 10:26544662-26544684 CTGACAAGAGGTTCCCAGCATGG + Intronic
1066469976 10:35688830-35688852 CTGAGGATAATTATCCGGCATGG - Intergenic
1068528867 10:58162565-58162587 CTGAGGAGGAGTACACAGGAAGG - Intergenic
1068568819 10:58606162-58606184 GTGAGGAGAAATTCCCAGGATGG - Intronic
1068600766 10:58954218-58954240 CTCAGGTGGAGAACCCAGCAAGG + Intergenic
1068604123 10:58986865-58986887 CTGAGGTGGAGAACCTAGCAAGG + Intergenic
1070331875 10:75423277-75423299 CTGTGGAGAACAACGCAGCAGGG - Intergenic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1072782124 10:98258194-98258216 CTGAGGAGGAGGCACCAGCAGGG + Intronic
1074014568 10:109521049-109521071 CTGAGGAAAATGACCCAGTAAGG + Intergenic
1074157571 10:110812072-110812094 CTTAGGAGAAGTCCTCTGCACGG + Intronic
1075647679 10:124107385-124107407 CTGCTGAGCAGTGCCCAGCAGGG + Intergenic
1075663794 10:124216574-124216596 CTCAGGAAAAGAGCCCAGCAAGG - Intergenic
1076494768 10:130889833-130889855 CTGAGGAGCAGTACACAGTATGG + Intergenic
1076981312 11:206441-206463 CTTGGGAAAAGTACCCAGCAAGG + Intronic
1077403982 11:2374583-2374605 GGGAGGAGAAGAACCCAGCCGGG + Intergenic
1077621538 11:3729296-3729318 CTGAGAAGCAGCAACCAGCAAGG + Intronic
1078722268 11:13896086-13896108 CAGAGGAGAAGTGCCCAGACAGG - Intergenic
1080715720 11:34797933-34797955 CTGGGGAGCTGTACCCTGCAAGG + Intergenic
1081514400 11:43811411-43811433 ATGAGGTGAAGTACACACCAAGG - Intronic
1083437000 11:62649426-62649448 CTGAACAGAGGTATCCAGCAAGG + Exonic
1083938288 11:65881740-65881762 CTGCAGGGAAGCACCCAGCAGGG + Intronic
1087980561 11:104608432-104608454 ATGAAGACAAGTAACCAGCATGG + Intergenic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1095201787 12:39393329-39393351 ATGAGTAGCAGAACCCAGCAGGG + Intronic
1096204015 12:49706814-49706836 CTTAGGAGAAGTCCCCAGTTCGG - Intronic
1097144804 12:56932861-56932883 CTAAGGAGAAGAATCAAGCAGGG + Intronic
1097640445 12:62174401-62174423 CTGAGGAAGAGGAGCCAGCAAGG + Intronic
1102100334 12:110273435-110273457 CTGAGGAGAGGTCCCAAGGAAGG + Intergenic
1106424585 13:29613784-29613806 CACAGGAAAAGTTCCCAGCATGG - Intergenic
1106755955 13:32822758-32822780 GTGTGGAGAAGTTCTCAGCAAGG - Intergenic
1107827795 13:44345250-44345272 CTGTGGAATACTACCCAGCAAGG - Intergenic
1114178236 14:20343111-20343133 CTGAGGTGAGGTACCCCGCAGGG - Intergenic
1115487160 14:33922285-33922307 CTGAGGAAATGTACTCAGAATGG - Intergenic
1116154782 14:41189443-41189465 CTGAAGGGAAGTACACAGCCTGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1117958412 14:61140385-61140407 CTGATGAGTAGGGCCCAGCATGG - Intergenic
1118686408 14:68295717-68295739 AAGAGGAGTAGTACGCAGCAGGG - Intronic
1120071581 14:80109215-80109237 CTGGGGCAAAGTACCCAGCAGGG + Intergenic
1120761895 14:88292582-88292604 CTGAGGTGATGTACCCACCTCGG + Intronic
1124027822 15:25983004-25983026 CAGACTAGAAGCACCCAGCAGGG - Intergenic
1124665274 15:31586860-31586882 AGGAGGAGGAGGACCCAGCAGGG - Intronic
1125462601 15:39920699-39920721 CTGGGAAGCAGGACCCAGCACGG - Exonic
1125478055 15:40060970-40060992 ATTCGGAGAAGTAGCCAGCAGGG + Intergenic
1128505809 15:68271918-68271940 CTTAGGAGCCGTGCCCAGCATGG - Intergenic
1130627939 15:85535159-85535181 CTGAGGAGAAATACCCAGAGGGG + Intronic
1131734440 15:95317081-95317103 CTGAGGAGTAGTAACCAGAGGGG + Intergenic
1132114550 15:99126012-99126034 ATGGTGAGAAGTACCCAACAAGG - Intronic
1134113696 16:11532298-11532320 TAGAGAAGAAGTAACCAGCAGGG + Intergenic
1135585265 16:23665461-23665483 CTGACGAGAAGGAGGCAGCAAGG - Intronic
1137667880 16:50262233-50262255 CTGAGGAGAAGTACCCAGCAGGG - Intronic
1137871062 16:51950807-51950829 CTCAGCAGAAATACCCACCAAGG - Intergenic
1139927172 16:70495889-70495911 CTGAGGAGAGGCCCGCAGCATGG - Intronic
1143342131 17:6219838-6219860 GTGAGGAGAAGTACAAGGCATGG + Intergenic
1144620288 17:16814571-16814593 CTGAGCAGAAGCTCCCAGCTGGG + Intergenic
1144843875 17:18205777-18205799 CTGGGGAGAAGTAAGCAGGAGGG - Intronic
1147571674 17:41575449-41575471 CTGAGCAGAAGCTCCCAGCTGGG + Intergenic
1148215354 17:45831020-45831042 CTGAGGGGAAAAAGCCAGCATGG - Intronic
1148537759 17:48455103-48455125 CTTAGGAGAAGTGTACAGCAGGG + Intergenic
1148712461 17:49691733-49691755 CTGAGGAGAGTAACACAGCAGGG + Intergenic
1152728233 17:81958075-81958097 CTGGGGAGGAGGCCCCAGCATGG - Intronic
1156065236 18:33134822-33134844 CAGAGGAGAAGATACCAGCATGG + Intronic
1157479408 18:48043990-48044012 AAGAGGAGAAGGATCCAGCATGG + Intronic
1158070957 18:53470017-53470039 CTGAGGAGGAGCAGCCAGAAGGG - Intronic
1159927448 18:74281874-74281896 CTGATGAGAATAACCCAGCAGGG + Intronic
1159942015 18:74415376-74415398 GTGAGGAGATGCACCCAGCCCGG - Intergenic
1160055286 18:75473023-75473045 CAAAGGAGATGTACCCTGCAGGG - Intergenic
1160435321 18:78847650-78847672 CTGAGGAGAAGGTTCTAGCAAGG - Intergenic
1160857707 19:1224759-1224781 GTGAGGAGGAGTACCCAGCAGGG + Intronic
1162513591 19:11134827-11134849 CCCAGGAGAAGGACCCAGAAGGG + Intronic
1163330504 19:16634253-16634275 CTCATGTGAAGTCCCCAGCATGG - Intronic
1164456571 19:28412350-28412372 CTGCGCAGCAGAACCCAGCAAGG + Intergenic
1164493567 19:28736654-28736676 CTGGGCAGAAGCAGCCAGCATGG - Intergenic
1164526162 19:29015102-29015124 CGGAGGAGCAGCACACAGCAGGG - Intergenic
1165462450 19:35952101-35952123 CTGAGGAGGAGAGGCCAGCATGG + Intergenic
1166723395 19:45010597-45010619 AGGAGGAGAAGCAGCCAGCATGG + Intronic
925873583 2:8292838-8292860 CTGAGGAGAAGAGCTCACCAGGG - Intergenic
928368634 2:30722708-30722730 AAGAGGAAAAGTACCCAGCAAGG - Intergenic
928399701 2:30969035-30969057 CAGAGGGGAAGGAGCCAGCATGG + Intronic
929286446 2:40140422-40140444 CTGAGAAGGAGTTCCCAGCATGG - Intronic
929461354 2:42103965-42103987 CTGAGGGGAGAAACCCAGCAAGG + Intergenic
930248909 2:49013611-49013633 CTGAGGAGGAGTACATAGCTGGG + Intronic
931448421 2:62346992-62347014 CTGAGGGGGAAAACCCAGCAAGG + Intergenic
933344713 2:81068139-81068161 CAGAGAAGAAGTACCCAACCAGG - Intergenic
935504642 2:103885179-103885201 GTGAGGAGAGAAACCCAGCAAGG + Intergenic
937482372 2:122276157-122276179 ATGAGGAGAAGTGACCAGGAGGG + Intergenic
938627008 2:133121431-133121453 CTGAGAAGAGGTACCCAGATGGG + Intronic
939095525 2:137829412-137829434 CTGAGGAGAAGGAGCCTTCAGGG - Intergenic
939540869 2:143492180-143492202 GCGAGGAGAAGAACCAAGCAGGG - Intronic
941444783 2:165587400-165587422 CTCTGGAGTAGTACCCAGCCAGG + Intronic
942720504 2:178947361-178947383 CTGAGGAGATGTACAAAGGAAGG + Intronic
944496463 2:200312005-200312027 CTGAGGAGTTGAACCCAGCTAGG + Intronic
944595281 2:201255492-201255514 CTGAGGAGCAGTACTGAGAATGG - Intronic
944616303 2:201464651-201464673 CTGAAGAGAAGGACACAGCCTGG - Intronic
945983989 2:216339970-216339992 CTGGGGAGGAGAGCCCAGCAGGG - Intronic
946907440 2:224430256-224430278 CTGAGTACAGGTACCCAGAAAGG + Intergenic
1169069281 20:2712766-2712788 ATGAGAAGAAGTGACCAGCAAGG + Intronic
1170207095 20:13810243-13810265 CTGAGAAGGAGTAGCCAGCAAGG + Intronic
1170385523 20:15811974-15811996 CTGAGGACAGGTAGCCAGGAAGG + Intronic
1172419081 20:34798398-34798420 CTGAAGGGAAGGACACAGCATGG + Intronic
1172653392 20:36521632-36521654 CTCAGGACAAGTCCTCAGCAGGG + Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175952675 20:62591625-62591647 AGGAGGAGCAGCACCCAGCATGG + Intergenic
1180912831 22:19464831-19464853 CCAAGGACAAGGACCCAGCAGGG + Intronic
1181507552 22:23370317-23370339 CTGAGGAGAGGAAGCTAGCAAGG + Intergenic
1182882541 22:33745893-33745915 CTGTGGAGAACTAACCAGGAGGG + Intronic
1184424751 22:44402923-44402945 CTGGGAGGAAGTGCCCAGCAGGG + Intergenic
1185140954 22:49100959-49100981 CTCAGCAGAAGCACCCGGCAAGG + Intergenic
950473146 3:13198903-13198925 CTGAGGAGAAATGCCCAGGACGG + Intergenic
950831417 3:15879217-15879239 CTGAGAAGAAGTACTCACCGGGG - Intergenic
951157126 3:19369363-19369385 CTGAGTAGAAACATCCAGCAAGG - Intronic
954920945 3:54190319-54190341 GTGAGGTGAGGTACCCAGAAAGG + Intronic
960006129 3:112782902-112782924 CTGAGGGGATAAACCCAGCAAGG - Intronic
962536344 3:136332783-136332805 TTGAGCAGAAGTACCAACCATGG + Intronic
967819274 3:193826160-193826182 CTGTGGAGAAGAACCAAGCATGG - Intergenic
968131137 3:196193604-196193626 CTGAGGTGAGGAAACCAGCATGG - Intergenic
969355467 4:6622792-6622814 CTGAAGGAAAGTACCCAGAAAGG + Exonic
969483611 4:7459681-7459703 CTCAGGAGGACTTCCCAGCATGG + Intronic
973324590 4:48845930-48845952 CTAAGGAGAAGTAGCAAGAATGG - Intronic
980882323 4:138724484-138724506 CTGAGCAGAAGTAGGTAGCAGGG + Intergenic
982177378 4:152718704-152718726 CTGAGGATAGATACACAGCAAGG + Intronic
983251851 4:165354485-165354507 CTGTGGACCAGTACCCATCATGG - Intergenic
986289403 5:6387700-6387722 CTGAGGAGCAGATCCCAGGATGG + Intergenic
986653069 5:9983684-9983706 CTGTGTAGGAGTGCCCAGCAGGG - Intergenic
986956761 5:13159864-13159886 GTGAGGAGAAACACACAGCATGG - Intergenic
990198323 5:53343486-53343508 CTAAGCTGAAGGACCCAGCAGGG + Intergenic
990623498 5:57585831-57585853 CATAGGAGAAGCACTCAGCATGG - Intergenic
996499802 5:124203983-124204005 CAGGGGAGATGTACCCTGCAGGG + Intergenic
997845160 5:137279279-137279301 CAGAGGAGAAGTAACAAGAAAGG + Intronic
998054434 5:139062403-139062425 CTTAGAAGAGTTACCCAGCATGG + Intronic
1002294513 5:178222859-178222881 CTTGGGAGAAGTAGCCAGCAGGG + Exonic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1005699291 6:28383743-28383765 CTGATGAGCAGTGGCCAGCAGGG - Intronic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1006257961 6:32845920-32845942 TTGCGGAGAAGTACTCAGAATGG - Intronic
1007660912 6:43485566-43485588 CAGAGGAGAGGTACCTAGCTGGG - Intronic
1011402476 6:86978805-86978827 CTGAGCAGAAGAAACCTGCATGG - Intronic
1011715003 6:90096303-90096325 TGAAGGAGAAGTAACCAGCATGG - Intronic
1014740097 6:125139733-125139755 CTGAGGAGGGAAACCCAGCAAGG + Intronic
1015316875 6:131826897-131826919 TTCAGGTGAAATACCCAGCATGG + Intronic
1018655120 6:166026975-166026997 CTGGGGAGAATTGCCCAGCGGGG - Intergenic
1025155786 7:56605292-56605314 GGGAGGAGACTTACCCAGCACGG - Intergenic
1028669787 7:93388048-93388070 ATGAGGAGCAGCAACCAGCAGGG + Intergenic
1029039262 7:97555932-97555954 CTGAGGAGATGTTCTCAGCCAGG + Intergenic
1029114410 7:98229921-98229943 CTGAGGACAAGGGCCCGGCAGGG - Intronic
1030610035 7:111679438-111679460 CTGAGGGGGAAAACCCAGCAAGG + Intergenic
1032018715 7:128394974-128394996 CTGAGAAGAAGTACTCGCCAGGG + Exonic
1034929529 7:155150608-155150630 CAGAGGAGTGGTACCCAGAAGGG - Intergenic
1035621365 8:1037664-1037686 ATAAGGACAAGAACCCAGCAAGG - Intergenic
1037552530 8:19988808-19988830 CACAGGAGAATTGCCCAGCAAGG + Intergenic
1039290366 8:36088235-36088257 TGGAGGAGAAGAACCCCGCAAGG - Intergenic
1042183408 8:66113772-66113794 CTGAGGAGAAGGTCCCCGCCTGG - Intergenic
1044485566 8:92748900-92748922 CTCAGGAGAAGTTCCAAGCCTGG - Intergenic
1046568706 8:115934912-115934934 CTTAGGAGGAGTACCTAGCCTGG + Intergenic
1050927547 9:11284569-11284591 CTGAAGAGAAGTCACCAGGAAGG - Intergenic
1051682505 9:19622110-19622132 CGGAGTAGAAGTACACATCAGGG + Intronic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1058389820 9:104482784-104482806 CTGATGAGAAGTCCCCAAGAGGG + Intergenic
1058809685 9:108627379-108627401 CTGAGGAGAAGAAGCCAGAGTGG - Intergenic
1059205027 9:112456516-112456538 TAGAGGAGAAGCAGCCAGCAAGG - Intronic
1061145306 9:128794239-128794261 CTGAGGAGCAGCACCCAGGGTGG - Intronic
1062219500 9:135407150-135407172 CTGCAGAGTAGTACACAGCATGG - Intergenic
1189056231 X:37701961-37701983 CTAAGCAGAAGGACCCAGCTTGG + Intronic
1189373159 X:40445756-40445778 TTGAAGAGCAGTCCCCAGCAGGG - Intergenic
1190461418 X:50680133-50680155 CTGAGGAGAAGTGGCCAGTGAGG - Intronic
1191190546 X:57662086-57662108 CAGATGAGAAGTTGCCAGCAGGG + Intergenic
1196256134 X:113521408-113521430 CTGAGTAGGAAAACCCAGCAAGG - Intergenic
1197654422 X:129101039-129101061 CAGAGGAGACATACACAGCAGGG + Intergenic
1199199241 X:145067675-145067697 CTGAAGTGAAGTGCCTAGCATGG - Intergenic