ID: 1137669732

View in Genome Browser
Species Human (GRCh38)
Location 16:50272118-50272140
Sequence CAGGACATGCTGGAGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 300}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137669724_1137669732 2 Left 1137669724 16:50272093-50272115 CCATTCTTGCCTCCTCCCAGGGT 0: 1
1: 0
2: 7
3: 54
4: 433
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669727_1137669732 -10 Left 1137669727 16:50272105-50272127 CCTCCCAGGGTATCAGGACATGC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669719_1137669732 14 Left 1137669719 16:50272081-50272103 CCCAGGCTCTGCCCATTCTTGCC 0: 1
1: 0
2: 2
3: 30
4: 309
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669717_1137669732 20 Left 1137669717 16:50272075-50272097 CCTGGCCCCAGGCTCTGCCCATT 0: 1
1: 0
2: 6
3: 58
4: 614
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669726_1137669732 -7 Left 1137669726 16:50272102-50272124 CCTCCTCCCAGGGTATCAGGACA 0: 1
1: 0
2: 0
3: 27
4: 272
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669718_1137669732 15 Left 1137669718 16:50272080-50272102 CCCCAGGCTCTGCCCATTCTTGC 0: 1
1: 0
2: 5
3: 19
4: 325
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669722_1137669732 3 Left 1137669722 16:50272092-50272114 CCCATTCTTGCCTCCTCCCAGGG 0: 1
1: 0
2: 5
3: 41
4: 401
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300
1137669720_1137669732 13 Left 1137669720 16:50272082-50272104 CCAGGCTCTGCCCATTCTTGCCT 0: 1
1: 0
2: 4
3: 62
4: 542
Right 1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG 0: 1
1: 0
2: 0
3: 25
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137669732 Original CRISPR CAGGACATGCTGGAGGTGAC AGG Intronic
900487918 1:2932230-2932252 ACGGACAGGCTGGAGGGGACGGG + Intergenic
900975316 1:6012717-6012739 GAGGTCATGGTGGAGGTGATGGG + Intronic
900982618 1:6055041-6055063 CACGAGATGCTGGAAGGGACAGG + Intronic
901217062 1:7560869-7560891 CAGGCAGGGCTGGAGGTGACAGG + Intronic
901476489 1:9493591-9493613 CAGGACATACTGAGTGTGACTGG - Intergenic
902342430 1:15792781-15792803 CACGGCATGGTGGAGGTGGCTGG - Intergenic
902515703 1:16988349-16988371 CTGGCCATGCTCGAGGTGAAGGG + Exonic
902625501 1:17673897-17673919 CAGGACTTGCTCAGGGTGACTGG + Intronic
902987114 1:20161632-20161654 CAGAACAAGCTGGGGGTGCCAGG - Intronic
903033555 1:20480215-20480237 CAGGATATGCTTGAAGTGTCCGG - Intergenic
903226687 1:21897746-21897768 AAGGGCAGGCTGGGGGTGACTGG + Intronic
903976321 1:27152820-27152842 AAGGACATGCAGGAGCTGAGCGG - Intronic
904433637 1:30480277-30480299 CAGGACAGGATGGGGGTTACAGG + Intergenic
904495559 1:30884502-30884524 GAGGGCAGACTGGAGGTGACAGG - Intronic
904807360 1:33141286-33141308 CAGGCCAGGCTGGAAGGGACAGG - Intergenic
904820453 1:33239718-33239740 CAGGACAAGGTGGAGGTAATTGG - Intergenic
905147834 1:35902008-35902030 GATGACATGACGGAGGTGACAGG + Exonic
905933758 1:41807588-41807610 CACACCTTGCTGGAGGTGACAGG - Intronic
906154669 1:43606886-43606908 CCGGAGATGCTGTGGGTGACGGG + Exonic
906164402 1:43675166-43675188 CAGCACATGTTGGAGGTGGAGGG - Intronic
908457251 1:64315783-64315805 CAGGACAAGCTGAAGTTGAGGGG + Intergenic
910241556 1:85092170-85092192 CAGGTCATGTTGGTGGTCACTGG + Intronic
911467357 1:98272400-98272422 CAGGACAGGGTGGAGGTAATTGG + Intergenic
912943286 1:114063731-114063753 CAGGAGATGCTGAAGCTGATAGG - Intergenic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
918280843 1:183004133-183004155 CTGGATATGCTGGAGATGTCTGG - Intergenic
920694175 1:208169229-208169251 AAGGGCAGGCAGGAGGTGACAGG + Intronic
920738490 1:208557808-208557830 CAGGCCACACTGAAGGTGACAGG - Intergenic
921686406 1:218094050-218094072 GAGGACATGCTGGAGCTGAAGGG - Intergenic
922034444 1:221834809-221834831 AAGGACATGCTGTAGATGTCAGG - Intergenic
924024908 1:239821830-239821852 CAGGACCAGGTGGAGGTAACTGG + Intronic
1063896659 10:10689382-10689404 AGGGACCTGGTGGAGGTGACTGG - Intergenic
1066154776 10:32662915-32662937 CAGGGCACTTTGGAGGTGACTGG + Intronic
1066483434 10:35820533-35820555 GAGGACATGCTGGCTGTGAGTGG + Intergenic
1069487335 10:68832337-68832359 AAGGCCCTGCTGGGGGTGACAGG - Intronic
1069770948 10:70899567-70899589 CTGGACAGGCTGCAGATGACAGG + Intergenic
1070309223 10:75261270-75261292 CAGGACAAGCTAGAGGTGCTAGG - Intergenic
1070314409 10:75296319-75296341 TAGGATTTGCTGGAGGAGACCGG + Intergenic
1070917407 10:80163775-80163797 CAGGTCAGCCTGGAGGTCACAGG - Intronic
1072254965 10:93612852-93612874 AAGGACATGCTGGACTGGACTGG - Exonic
1072411528 10:95206962-95206984 CAGGACCTGATTGAGGTGAAAGG + Intronic
1074771790 10:116739649-116739671 CAGGTCATGCGGGAGGGGGCAGG + Intronic
1075528891 10:123210260-123210282 CAGGGCATGCTCGAGGTGGGGGG + Intergenic
1075587519 10:123668206-123668228 GGGGACAGGCTGGAGGTGTCAGG + Intronic
1075670604 10:124261695-124261717 CAGGACCAGGTGGAGGTAACTGG - Intergenic
1075908614 10:126104564-126104586 GAGGACAGTCTGGAGGTGAAGGG + Intronic
1075993980 10:126861609-126861631 CAGGAAAAGATGGAGATGACTGG + Intergenic
1076484507 10:130807405-130807427 GAGGGCATGTTGGAGGGGACAGG + Intergenic
1076740038 10:132478452-132478474 CAGGACCTGCTGCAGGGGAAGGG - Intergenic
1076745567 10:132511383-132511405 TGGGACCTGGTGGAGGTGACAGG - Intergenic
1076920993 10:133454593-133454615 CAGGAGAGGCTGGAGGTGAGAGG + Intergenic
1077003385 11:336952-336974 CAGGAAATGCTGCAGGCCACAGG - Intergenic
1077205161 11:1338482-1338504 CGGGACCAGGTGGAGGTGACTGG + Intergenic
1080855515 11:36108525-36108547 CAGGACACTCTGGAAGTGAATGG + Intronic
1082162794 11:48902021-48902043 CAGGCGATGCTGCAGGTGTCGGG + Intergenic
1082998597 11:59272199-59272221 CAGGAGCTGCTGGAGGGGAAAGG - Intergenic
1084083659 11:66844832-66844854 CAGGACAAGCTGTGAGTGACGGG - Intronic
1084626948 11:70315069-70315091 CAGGACCAGGTGGAGGTAACTGG - Intronic
1085282781 11:75341808-75341830 CAGGACATGCTTGGGGAGCCAGG + Intronic
1085320765 11:75572537-75572559 CAGGTCATTCTGGGGGTGCCTGG - Exonic
1085461306 11:76695531-76695553 CAAGACCTGCTGGAGCTCACTGG - Intergenic
1085503792 11:77044037-77044059 CTGGACAGGCGGGAGGTGATTGG + Intergenic
1085509421 11:77080616-77080638 CTGGACCTGCTGGAGGTAGCGGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1089197226 11:116701371-116701393 CACGACATGCTCAATGTGACAGG + Intergenic
1089609693 11:119662569-119662591 AAGGAGATGCAGGAGGAGACAGG + Exonic
1090245006 11:125209950-125209972 CAGCACATGCTCGAGGTCAGAGG + Intronic
1090390832 11:126386245-126386267 CAGGAAATGGTGGAGATGACGGG - Intronic
1091448763 12:559895-559917 GAGGACATCCAGGAGGTGCCGGG + Intronic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1092839059 12:12521203-12521225 GAGGTCAGGCTGGTGGTGACTGG + Exonic
1094463071 12:30719123-30719145 TACTACTTGCTGGAGGTGACTGG + Intronic
1095497548 12:42801268-42801290 CAGGACACCTTGAAGGTGACAGG + Intergenic
1095987420 12:48008756-48008778 TAGGACAGGATGGAGGAGACTGG - Intergenic
1098784218 12:74729373-74729395 CAGGAAATGCTGGTGGTCAGAGG - Intergenic
1099132900 12:78858771-78858793 GAAGACATGCTAGAGGTGATAGG - Intergenic
1099607792 12:84827783-84827805 CAGGACCAGGTGGAGGTAACTGG + Intergenic
1103163939 12:118754064-118754086 CAGGACATGCTGGAAGTTCTGGG - Intergenic
1103938078 12:124486936-124486958 CCGGCCATGCTGGCGTTGACTGG + Intronic
1103948055 12:124538010-124538032 CGGGACGTGCTGCAGGTGGCTGG - Intronic
1104098448 12:125583307-125583329 CTGGAGATTCTGGAGGTGTCGGG + Intronic
1104726418 12:131078281-131078303 CAGTGTTTGCTGGAGGTGACAGG - Intronic
1104933731 12:132353680-132353702 CAGGAGATGCTGCAAGTGGCGGG + Intergenic
1111355997 13:87103226-87103248 CAGGACATGCAAGAGGGGTCTGG - Intergenic
1112288412 13:98124213-98124235 CTGGAAATGGTGGAGGTGACGGG - Intergenic
1114660527 14:24340689-24340711 CAGGAGCTCCTGGAGGTGGCAGG + Intergenic
1118774210 14:68963203-68963225 CAGCCCATCCTGGAGGAGACAGG - Intronic
1119423155 14:74519928-74519950 CAGAACAGGCTGGAGGAGCCAGG - Intronic
1119661981 14:76458767-76458789 CAGAGCAGGCTGGAGCTGACGGG + Intronic
1119767095 14:77196939-77196961 GAGGAGTTGCTGGAGGTAACTGG - Intronic
1120899099 14:89560236-89560258 AGGGACCTGGTGGAGGTGACTGG - Intronic
1123054184 14:105561523-105561545 CAGGACAGGCTGGAAGTGGAGGG - Intergenic
1123100304 14:105793263-105793285 CAAGACACCCTGGAGGTGAAGGG - Intergenic
1124103973 15:26720344-26720366 CAGGAGCTGATAGAGGTGACAGG - Intronic
1124203246 15:27696550-27696572 CAGGACACGCAGGAAGGGACCGG + Intergenic
1129166832 15:73783275-73783297 CAGCAGATCCTGGAGGTGATAGG - Intergenic
1129243111 15:74263304-74263326 CAGCACAGACTGGAGGTGCCTGG + Intronic
1130184112 15:81662714-81662736 CAGGGCATGATTAAGGTGACTGG + Intergenic
1130188411 15:81708584-81708606 CAGGGCATGATTAAGGTGACTGG + Intergenic
1130668293 15:85888142-85888164 TAGTACATCCTGGATGTGACTGG + Intergenic
1132146161 15:99431294-99431316 CAGGAAATGTTGGTGATGACAGG - Intergenic
1132495208 16:259895-259917 CAGCACATGCTGGGGCTGGCCGG + Intronic
1133208215 16:4246852-4246874 CGGGAGATGCTGGAGGACACAGG + Intergenic
1133967673 16:10543389-10543411 CAGCACAAGCTGGAGATGCCAGG - Intronic
1134111621 16:11518563-11518585 CTGGACATGCTGGGGGTCACAGG + Intronic
1135571408 16:23552148-23552170 GAGGACATGCTGGAGTGGGCAGG - Exonic
1137392404 16:48092491-48092513 CAGGGCAGGCTGGAGGTTCCGGG - Intronic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1137989533 16:53139636-53139658 AAAGAGGTGCTGGAGGTGACTGG + Intronic
1138945383 16:61843009-61843031 CAGGACCTGCTGGAGGTGGATGG + Intronic
1140486632 16:75298794-75298816 CAGCACAACCTGGAGGTGATAGG - Intronic
1141146091 16:81531131-81531153 GAGGTCATGCTGGAGGAGAGTGG + Intronic
1141850301 16:86640531-86640553 CTGGACATGCTGGAGCTCAGAGG + Intergenic
1141944271 16:87298729-87298751 GTGGACAGTCTGGAGGTGACAGG - Intronic
1142264635 16:89058046-89058068 CAGGCCCTGGTGGAGGAGACAGG - Intergenic
1144037372 17:11379665-11379687 CAGGAGTTACTGGAGGTCACAGG + Intronic
1144788798 17:17846247-17846269 CAGTGCATGCTGGAGGGGACAGG + Intronic
1146528137 17:33584527-33584549 CTGAACCTGATGGAGGTGACAGG - Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147805392 17:43127108-43127130 CAGGCCACGCTGGAGCTCACAGG - Intergenic
1148820049 17:50354983-50355005 CGGGACCTGCTAGAGGTGCCTGG + Exonic
1150138809 17:62711741-62711763 CAGTACAAGCTGGATGTGTCGGG + Intronic
1150144027 17:62752978-62753000 AATGTCATGCTGGAGGCGACGGG - Intronic
1150410465 17:64937233-64937255 AAGAACGTGCTGGAGGTGAGTGG + Intergenic
1151327471 17:73388076-73388098 CAGGCCATGGTGGAGGGGGCTGG + Intronic
1152228923 17:79105127-79105149 CAGGACTGTGTGGAGGTGACTGG - Intronic
1152559965 17:81073017-81073039 GGGGTCATCCTGGAGGTGACAGG - Intronic
1154369234 18:13743539-13743561 CAGGAAAAGCTGGGGGTAACTGG + Intronic
1156141337 18:34115308-34115330 CTGGCCATGGTGGATGTGACTGG - Intronic
1156552137 18:38028831-38028853 CAAGAAAGGCTGGCGGTGACTGG - Intergenic
1157567616 18:48690343-48690365 TAGGTCATGCTAGAGGTGACTGG - Intronic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1159527807 18:69616312-69616334 CATGGCATGGTGGAGGTGAGGGG - Intronic
1160874675 19:1291481-1291503 CAGGTCTTGCTGGGGGTGGCAGG + Intronic
1160911142 19:1474328-1474350 CAGGACCTGCTGCAGCTGGCAGG + Exonic
1161317103 19:3622415-3622437 GAGGTCATCCTGGAGGTGGCGGG + Intronic
1161417703 19:4156981-4157003 CAGGACCTGCTGGGGTGGACAGG - Exonic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1162527819 19:11216876-11216898 CAGGAGATGATGGAGGAGGCAGG - Intronic
1162612950 19:11770321-11770343 AAGGACCTGTGGGAGGTGACTGG - Intronic
1162706582 19:12559595-12559617 CTGGACAAGCTGGACGTGAAAGG + Intronic
1163008274 19:14409689-14409711 CAGGACCTTCGGGAGGTCACTGG - Intronic
1163398454 19:17077359-17077381 CAGGATATTCTGGAAGTGAAGGG - Intronic
1165108417 19:33487649-33487671 CAGGCCAGGCTGGGGCTGACTGG - Intronic
1165150379 19:33756786-33756808 GAAGTCATTCTGGAGGTGACTGG - Intronic
1165434514 19:35788701-35788723 CAGGACATGCTGGGGGCTCCTGG - Exonic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
926127782 2:10282595-10282617 CTGGACAGGCTGGAGGTACCTGG - Intergenic
926424839 2:12731360-12731382 CAGGTCAAGTTGGAGGTGAGGGG - Intronic
927322925 2:21769338-21769360 CAGGAGGTGGTGGTGGTGACTGG + Intergenic
929434101 2:41914135-41914157 CAGGACAGGGTAGAGGTGAGTGG - Intergenic
929762515 2:44817777-44817799 CAGGAGATGGTGGGGGTGAGGGG - Intergenic
930107363 2:47650672-47650694 CACGTGATGCTGGAGGAGACTGG - Intergenic
931154869 2:59616398-59616420 AGGGACCTGGTGGAGGTGACTGG - Intergenic
931177407 2:59867890-59867912 CAAGTCATTCTGGAGATGACAGG + Intergenic
931802343 2:65770898-65770920 CAGAATATGCTACAGGTGACAGG - Intergenic
932800104 2:74734117-74734139 CAGGTCATGGTGGAGTTCACGGG - Intergenic
933757284 2:85649770-85649792 CAGAACTTGCTGGGGCTGACTGG - Intergenic
933943258 2:87262842-87262864 CAGCACATGATGGAGGAGAAGGG + Intergenic
934657888 2:96125512-96125534 CATGACCTGCTGGAGGAGAGGGG - Intronic
936052524 2:109235538-109235560 CAGGTGCTGCTGGAAGTGACTGG + Intronic
936336956 2:111598719-111598741 CAGCACATGATGGAGGAGAAGGG - Intergenic
937189966 2:120085772-120085794 CAGGACAAGCTGGAGGTATGAGG - Intronic
938171875 2:129085859-129085881 CAGGCCATGCTGGAGCAGAGGGG + Intergenic
940846892 2:158651523-158651545 CGGCACATGCTGGAGCTGGCTGG - Intronic
941063383 2:160873246-160873268 CAAGACATGCTGAAAGGGACAGG - Intergenic
943037834 2:182768198-182768220 CAGAACTTGATGGAGGTGAGAGG + Intronic
943365970 2:186967832-186967854 CAGGGCAAGCTGGAGGTGAGAGG - Intergenic
943518640 2:188919240-188919262 CAGGACCAGGTGGAGGTAACTGG - Intergenic
945882609 2:215342079-215342101 CAGGACTAGGTGGAGGTAACTGG - Intronic
946537370 2:220646508-220646530 CAGGGCCTGCTGGAGGGGAGTGG + Intergenic
947874048 2:233456981-233457003 AAGGTCTTGCTGGAGGTGAGTGG + Exonic
948364540 2:237446170-237446192 CAGGCCATGCGGGAGGGGTCAGG - Intergenic
948429922 2:237912620-237912642 GAGGACAAGCTGAAGGTGATGGG - Intergenic
1168782862 20:509438-509460 CAGCACATGCTGTAGGAGATAGG - Intronic
1170347105 20:15399484-15399506 CAGGAAATGCTCGAGGAAACAGG - Intronic
1170571629 20:17636040-17636062 CAGGACGTGCTGGAGGTCAGAGG - Intronic
1171179154 20:23079197-23079219 CTGCACCTGCTGGAGGCGACAGG - Intergenic
1173342049 20:42161602-42161624 CAGGCCAAGCTGGGGGAGACAGG - Intronic
1173647234 20:44641075-44641097 CAGGCCCTGCTGGAGGTCACAGG + Intronic
1174167103 20:48592789-48592811 CAGGACAGGCTGCAGGTGAGAGG + Intergenic
1175980637 20:62736831-62736853 CAGGACCAGGGGGAGGTGACTGG + Intronic
1176182181 20:63755155-63755177 CAGCACATGCAGGTGGTGAGGGG - Intronic
1178817267 21:35943138-35943160 GAGGACAGGCTGGAGCTGTCTGG - Intronic
1180117418 21:45719519-45719541 CAGGACCAGGTGGAGGTAACTGG + Intronic
1180799427 22:18624889-18624911 CAGGACAGGCAGGAGGGCACAGG - Intergenic
1180876134 22:19176080-19176102 CAGGACACTCTGGCGGTGCCTGG + Exonic
1181222291 22:21370377-21370399 CAGGACAGGCAGGAGGGCACAGG + Intergenic
1181487280 22:23239255-23239277 CAGGACATTCAGAACGTGACTGG + Intronic
1181638050 22:24183370-24183392 CAGGACAGGCAGGAGGGCACAGG + Intronic
1182285888 22:29246703-29246725 CAGGCCAGGCTGAAGGAGACTGG + Intronic
1182960202 22:34465021-34465043 CAGGCCAGGCTGAAGGTGGCAGG + Intergenic
1183075575 22:35424527-35424549 GAGGGCACGATGGAGGTGACAGG - Exonic
1183083760 22:35474112-35474134 CTGGACAGGCTGGTGGTGAGAGG + Intergenic
1184077849 22:42194705-42194727 CAGGGCATGGTGGAGGAGACTGG + Intronic
1184093582 22:42304898-42304920 CAGGTTAAGCTGGAGGTCACGGG - Intronic
1184282093 22:43443100-43443122 CAGGGTAGGCTGGTGGTGACTGG + Intronic
1184311765 22:43650137-43650159 CAGGACCTCCTGGAGGGGAAGGG + Intronic
1184393606 22:44219645-44219667 CTGGACAGGCGGGAGGTGACCGG + Intergenic
1184419559 22:44371768-44371790 CAGGACAGGGTGCAGGTGTCTGG - Intergenic
1184494106 22:44827292-44827314 CACCACATCCTGGAGGTGTCAGG - Intronic
1185419625 22:50728245-50728267 CAGAGCATGCTGGAGATGTCAGG - Intergenic
950910271 3:16582344-16582366 CATAAAATGCTGGAGGTGGCAGG - Intergenic
952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG + Intergenic
952533187 3:34283182-34283204 CAGGCCATGCTGGCAGTAACAGG - Intergenic
953033230 3:39191303-39191325 CAGGCCACCCTGGTGGTGACAGG - Intronic
953768381 3:45761025-45761047 CAGGACATGCAGCAGGTCCCAGG - Intronic
954463009 3:50638340-50638362 CAGGACATGGTGGAGGCAAGTGG + Intronic
959742433 3:109736661-109736683 CAGGACCAGGTGGAGGTAACTGG - Intergenic
959900545 3:111656860-111656882 CAAGAAATGCTGGAGTTGAGGGG + Intronic
961500364 3:127328266-127328288 CTGGACATGCTGTAGGTGCTTGG - Intergenic
961514828 3:127426016-127426038 CAGGACTCACTGGAGGTGGCAGG - Intergenic
961619641 3:128213475-128213497 CAAGACATGGTAGAGGTCACAGG + Intronic
962255935 3:133870321-133870343 CAGGACCAGGTGGAGGTGATTGG - Intronic
962563479 3:136633077-136633099 CAGGGCATGGGGGAGGTGAAAGG + Intronic
966750610 3:183318060-183318082 CGGGACAAGCTGCAGGTGAGCGG - Exonic
967313316 3:188127128-188127150 CAGGTGGGGCTGGAGGTGACAGG - Intergenic
967821920 3:193846481-193846503 CAGGACAGGTTGGAGGAGAAGGG - Intergenic
968504701 4:966458-966480 CAGGACATCCGGCAGGTGAGTGG - Exonic
968530316 4:1087554-1087576 CAGGACAGGGTGGGTGTGACAGG + Intronic
968530761 4:1090202-1090224 CAAGACAGGGTGGGGGTGACAGG + Intronic
968574307 4:1357886-1357908 CAGGCCATGCAGGAGGGTACTGG + Intronic
968711930 4:2125754-2125776 CAGGAGGAGCTGGAGCTGACTGG + Intronic
968922662 4:3530752-3530774 GAGGACCAGCTGGAGGTGGCTGG + Intronic
968978715 4:3835296-3835318 CAGGATGAGGTGGAGGTGACAGG + Intergenic
969627954 4:8317229-8317251 CAGGGCCTGCTGGAGGGGCCGGG - Intergenic
969692045 4:8709163-8709185 CAGGAATGCCTGGAGGTGACAGG + Intergenic
970284610 4:14496136-14496158 CAGGTACTGCTGGAGGTCACTGG + Intergenic
976530419 4:86145813-86145835 GAGGAAATGCTGGATGTTACAGG - Intronic
976586857 4:86808095-86808117 GAGGACATACTGGAGGAAACTGG - Intronic
979337012 4:119475083-119475105 CAGAGCATGCTGGAAGTGCCAGG + Intergenic
981980098 4:150781509-150781531 CAGGCCATGCAGGAGGTGAGCGG - Intronic
984756307 4:183328666-183328688 CAGGACATTCAGGGGGTGAATGG + Intergenic
985025571 4:185736430-185736452 CTGGGCATTCTGGAGGTTACTGG + Intronic
985302104 4:188500998-188501020 CTGGACTTGCTCAAGGTGACTGG + Intergenic
985563303 5:602766-602788 CAGCAGAAGCTGGAGGCGACGGG - Intergenic
986329212 5:6705100-6705122 CAGGAGATTCTGGAGGTAAGGGG - Intergenic
987421475 5:17725490-17725512 TAGGCCATGCTGGAGGAGAGAGG - Intergenic
989063510 5:37434261-37434283 CAGGACCAGGTGGAGGTAACTGG - Intronic
990771012 5:59245230-59245252 AAGGACATGTTGGAAGTGACAGG + Intronic
990815199 5:59777006-59777028 CTGGACATGCTGGAGGATGCAGG - Intronic
991286764 5:64985959-64985981 CAGGACCAGGTGGAGGTGATTGG + Intronic
991743647 5:69709519-69709541 CAAGACATGCTGCAGGCTACGGG + Intergenic
991795220 5:70289251-70289273 CAAGACATGCTGCAGGCTACGGG + Intergenic
991833378 5:70720836-70720858 CAAGACATGCTGCAGGCTACGGG - Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
998639640 5:143995195-143995217 AAGGACATGCTGCTGGTGAGTGG + Intergenic
1000690670 5:164315784-164315806 CAGAATATGCTGGATTTGACTGG + Intergenic
1002051788 5:176575560-176575582 CAGGAGATGCTGTAGATCACAGG - Exonic
1002097313 5:176839172-176839194 GTGGACATGATGGAAGTGACAGG - Intronic
1002285804 5:178162018-178162040 CAGGATTTGTTGGATGTGACAGG + Intergenic
1002765173 6:233115-233137 GAGGTCATGCTGGAGGAGAGTGG + Intergenic
1002834501 6:854614-854636 GAGGACACGTTGGACGTGACCGG + Intergenic
1005419115 6:25630955-25630977 GAGGAAATGCTGGAGGAGGCTGG - Intergenic
1006363517 6:33600879-33600901 CAGGGCAGGCTGGAGGTGCCAGG + Intergenic
1007252866 6:40508243-40508265 CAGGACATGCTGCAGGTAAGGGG + Intronic
1007693931 6:43719763-43719785 CAGGAGATGCCGGAGGAGTCCGG - Intergenic
1007914330 6:45546946-45546968 AGGGACATGCCTGAGGTGACTGG - Exonic
1010269387 6:73903442-73903464 CAGGCCATGCAGGAGGCCACCGG - Intergenic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013167477 6:107606762-107606784 CAGGAGAGGCTGGACTTGACTGG + Intronic
1015616188 6:135077993-135078015 TAGAAGATGCTGGAGGTGCCAGG + Intronic
1017403810 6:154094902-154094924 AAGGACATGCTGCATGAGACAGG + Intronic
1018104339 6:160468573-160468595 CAGGACCAGGTGGAGGTAACTGG - Intergenic
1018112529 6:160549171-160549193 CAGGACCAGGTGGAGGTAACTGG - Intronic
1018704320 6:166451225-166451247 CAGGAGAGTCTGTAGGTGACAGG + Exonic
1018782092 6:167077332-167077354 CAAGCCATTCTGGAGGTCACTGG - Intergenic
1018882901 6:167903267-167903289 CTGGTCTTGCTGGTGGTGACTGG + Intronic
1018983960 6:168621779-168621801 TAGGACCAGGTGGAGGTGACTGG - Intronic
1020275889 7:6624129-6624151 CAGGTCAAGCAGGAAGTGACTGG - Exonic
1022312537 7:29210704-29210726 CAGGAAATGCTGGGGGTAAGGGG + Intronic
1022332725 7:29395968-29395990 CAATAAATGCTTGAGGTGACAGG + Intronic
1023091005 7:36617259-36617281 CAGGACATCCTGGAGGGCACAGG + Intronic
1023394916 7:39743756-39743778 CTGGACATGCTGGAGGTAGGGGG + Intergenic
1024528886 7:50374031-50374053 CAGGATCTGATGGAGGAGACAGG + Intronic
1025724469 7:64044422-64044444 CAGAACTTACTGGAGATGACAGG - Intronic
1026607243 7:71826610-71826632 CAGACCATGTTGGAGGGGACAGG + Intronic
1028726223 7:94090767-94090789 CAGCACAGGGCGGAGGTGACCGG - Intergenic
1029144664 7:98437210-98437232 CATGACCTGCTGAAGGTGACAGG + Intergenic
1030727391 7:112941077-112941099 CAGGAGAAGCGGGAGGTGAAGGG + Intergenic
1031196424 7:118620260-118620282 GAGGAGATGCTGGAGGAGGCTGG - Intergenic
1031197102 7:118628933-118628955 GAGGAGATGCTGGAGGAGGCTGG + Intergenic
1031339711 7:120583963-120583985 CAGGACATCAGGGAGGTCACGGG + Intronic
1032458808 7:132094188-132094210 CAGGACATGCTAGAGAGGTCAGG - Intergenic
1032793391 7:135258818-135258840 CAGGACATGCTGAAAGTACCTGG - Intergenic
1034997331 7:155586506-155586528 CAGGACATGGGGGAGCTGATGGG - Intergenic
1036599182 8:10243338-10243360 AAGGACAAGCTGTAGGTGAGTGG - Intronic
1037261354 8:17012504-17012526 CAGGGCAAGTAGGAGGTGACTGG - Intergenic
1037506796 8:19538699-19538721 CAAGACAAGCTGGAGATGGCTGG + Intronic
1039660011 8:39450881-39450903 CAGGACATGCGGCAGGGGAGTGG - Intergenic
1040594398 8:48823385-48823407 CAAGACATGCTAGAAGTGATGGG + Intergenic
1047512727 8:125528076-125528098 CAGGTCATGCTGGACATGGCAGG - Intergenic
1047627378 8:126669857-126669879 CTGGAAGTGATGGAGGTGACAGG - Intergenic
1049270566 8:141693475-141693497 AAGGCCATGCTGGTGGTGATGGG + Intergenic
1049369080 8:142254922-142254944 CAGGACCTGTTGGAGGGGCCTGG - Intronic
1049492214 8:142911473-142911495 CAGGGCATGCTCGAGCTGCCTGG + Exonic
1052755491 9:32536821-32536843 CAGGTGAAGCTGAAGGTGACTGG - Intergenic
1053055669 9:34991837-34991859 CAGGCCCTGCTGCAGGTGGCTGG - Intronic
1054923358 9:70563865-70563887 CACGACATGCGTGAGCTGACTGG - Intronic
1054937984 9:70709697-70709719 CAGGACTTGCTGTAGATGATGGG - Intronic
1054939675 9:70727690-70727712 CAGGACTTGCTGTAGATGATGGG - Intronic
1056275877 9:84993676-84993698 CAGGACATGCAGGATGTCGCAGG - Intronic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1057389813 9:94633583-94633605 CAGTTCAGGCTGGAGGTCACAGG - Intronic
1058880354 9:109280389-109280411 AAAGACCTGCTGGAGGTCACAGG + Intronic
1060934393 9:127506980-127507002 CAGGAGATGCTGGAGGGGTGAGG + Exonic
1061716388 9:132521041-132521063 GAGGACAGGCTGGAGGAGCCAGG - Intronic
1062582589 9:137235083-137235105 GGGGACCTGCTGGAGGTGAGTGG - Intronic
1062722654 9:138052487-138052509 AGGGAGATGCTGGAGGTGAGGGG + Intronic
1186360113 X:8832103-8832125 CAGGAGAAGCTGAAGGTAACAGG + Intergenic
1187942278 X:24393551-24393573 GAGGTGATGGTGGAGGTGACAGG + Intergenic
1189818250 X:44845526-44845548 AAGGAGATGTTAGAGGTGACAGG - Intergenic
1190128700 X:47726841-47726863 CAGGACAGGCTGGAAAGGACAGG - Intergenic
1191852370 X:65594953-65594975 CATTACATGCTGGAGGTGTAGGG - Intronic
1193401703 X:81053541-81053563 CAGGGCCTGCTGGGGGTGAGGGG - Intergenic
1194589816 X:95786209-95786231 CAGGACCAGGTGGAGGTGATTGG + Intergenic
1195713773 X:107797891-107797913 GAGGACTGGTTGGAGGTGACTGG - Intergenic
1196864129 X:120055400-120055422 CAGGACCAGGTGGAGGTAACTGG + Intergenic
1196878970 X:120180930-120180952 CAGGACCAGGTGGAGGTAACTGG - Intergenic
1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG + Exonic
1200016563 X:153168953-153168975 CAGGACAAGCTGAAGGTAATTGG + Intergenic
1202276372 Y:23124879-23124901 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202289656 Y:23295811-23295833 CATGAAATGCTGGAGGTGGCAGG + Intergenic
1202429366 Y:24758604-24758626 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202441425 Y:24911486-24911508 CATGAAATGCTGGAGGTGGCAGG + Intergenic