ID: 1137669763

View in Genome Browser
Species Human (GRCh38)
Location 16:50272245-50272267
Sequence CCTTCTAGGGCCCGGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137669750_1137669763 22 Left 1137669750 16:50272200-50272222 CCCTGGAAGGCAGAAGGTACCTG 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1137669763 16:50272245-50272267 CCTTCTAGGGCCCGGATCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 101
1137669751_1137669763 21 Left 1137669751 16:50272201-50272223 CCTGGAAGGCAGAAGGTACCTGC 0: 1
1: 0
2: 2
3: 25
4: 216
Right 1137669763 16:50272245-50272267 CCTTCTAGGGCCCGGATCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 101
1137669754_1137669763 3 Left 1137669754 16:50272219-50272241 CCTGCAGTGGGTGATGCCACCAC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1137669763 16:50272245-50272267 CCTTCTAGGGCCCGGATCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137669763 Original CRISPR CCTTCTAGGGCCCGGATCCC TGG Intronic
900201952 1:1411982-1412004 CCATCTAGGTCCCAGGTCCCAGG + Intergenic
900201970 1:1412040-1412062 CCATCTAGGTCCCAGGTCCCAGG + Intergenic
900201983 1:1412081-1412103 CCGTCTAGGTCCCAGGTCCCAGG + Intergenic
900201991 1:1412105-1412127 CCGTCTAGGTCCCAGGTCCCAGG + Intergenic
900788837 1:4666389-4666411 CCATCTAGGGCCAGGGTCCCAGG + Intronic
900802285 1:4744919-4744941 CCTAATAGGGCCCGGATTCGGGG + Intronic
900968169 1:5974043-5974065 CCTTCCAGGGCCTGGATTCTTGG - Intronic
902415605 1:16237011-16237033 CCTTCTAGATCCCGACTCCCAGG + Exonic
904696844 1:32335874-32335896 CCTTCTAGGGCCCGGGGCCGGGG - Intronic
906519510 1:46458860-46458882 CCTTCTGGGACCCTGGTCCCTGG + Intergenic
912383634 1:109260700-109260722 GGTTGTAAGGCCCGGATCCCGGG - Intronic
917605705 1:176626799-176626821 CCTTTTTGGGCCAGGAGCCCAGG + Intronic
919907067 1:202085521-202085543 CCTCCTGGGGCTCGGGTCCCAGG - Intergenic
922447555 1:225710333-225710355 ACTTCTAGTGCCAGGAGCCCAGG - Intergenic
1065993020 10:31031559-31031581 CCTTCTAAGGCCTCGCTCCCAGG + Intronic
1066183046 10:32981802-32981824 CCTGGTAGGGCCAGGACCCCAGG + Intronic
1069569526 10:69485937-69485959 CCTGCCAGGGCCAGGATGCCAGG - Intronic
1072916620 10:99540814-99540836 CCTTCCAGGGCTCGGGCCCCTGG - Intergenic
1075080537 10:119380720-119380742 CCATCTAGGGCTCTGAGCCCAGG + Intronic
1077231839 11:1461238-1461260 CCTTCTGGGGCCAGGACCCCTGG + Exonic
1077369864 11:2176865-2176887 CCCTCTAGAGCCTGGCTCCCAGG + Intergenic
1080387152 11:31816913-31816935 GCTTTTAGGGCCGGGCTCCCAGG + Intronic
1081849571 11:46265675-46265697 CCTGGTTGGGCCCGGATGCCAGG + Intergenic
1082050450 11:47766905-47766927 CCTTCTGCGGCCCGGAGCCCAGG + Intronic
1083667685 11:64284684-64284706 GCAACTAGGGCCCGGAGCCCGGG - Exonic
1083758179 11:64802390-64802412 CCTGCTGGGGCCTGGAGCCCTGG + Intronic
1084604385 11:70164065-70164087 CCTTCTATGGCCAGGATCGCTGG - Intronic
1085562813 11:77487551-77487573 CCCTTTAGGGCCCTGGTCCCAGG - Intergenic
1096793035 12:54056949-54056971 CTTGCTAGGGCCTGGATCTCAGG - Intergenic
1097155861 12:57011924-57011946 CCTTCTGGGCCCCGTAACCCAGG + Intronic
1097451091 12:59737746-59737768 GCTTCTAGGGCCAGGAACACTGG - Intronic
1104358641 12:128111609-128111631 CCGTGTTGGGCCTGGATCCCAGG + Intergenic
1106085727 13:26540123-26540145 CCTTCTAGGGCTCTGCTCCCTGG - Intergenic
1112901392 13:104362455-104362477 CCTTCTATGGCCAGGACCACAGG + Intergenic
1113960727 13:114124436-114124458 CCTCGTCGGGCCTGGATCCCCGG - Intronic
1114643445 14:24240262-24240284 CCTCCTAGGGCCAGGAAGCCAGG - Exonic
1124249216 15:28096446-28096468 CCTTCTAGTTCCCGGATCCCAGG + Intronic
1124590645 15:31050305-31050327 CCACCCAGGGCCCTGATCCCAGG - Intronic
1133156738 16:3881009-3881031 CCCGCTGGGGCCCGGAGCCCCGG - Intergenic
1137669763 16:50272245-50272267 CCTTCTAGGGCCCGGATCCCTGG + Intronic
1143634186 17:8154913-8154935 CAGTCTAGGGCCTGGATCCTGGG + Intronic
1144726202 17:17503945-17503967 CCACCCATGGCCCGGATCCCAGG + Intergenic
1145268072 17:21390024-21390046 CTTTCTCGGGCCCAGCTCCCAGG + Intronic
1148032074 17:44628432-44628454 CCTTCCAGGCCTCAGATCCCAGG + Intergenic
1151836256 17:76584965-76584987 CCTGCTAGAGGCCGGCTCCCAGG + Intronic
1152362951 17:79840745-79840767 CCTTCAAGAGCCCGGAGCCGGGG - Intergenic
1152617595 17:81345121-81345143 CCTCCTAGCCCCCGGAGCCCCGG - Intergenic
1153031079 18:712959-712981 CCCTCTAGGGCGCGGCTCCCGGG - Intergenic
1154041517 18:10860427-10860449 GCTCCTAAGGCCCGGGTCCCAGG + Intronic
1160431798 18:78818221-78818243 ACTCCGAGGGCCCAGATCCCAGG - Intergenic
1160681413 19:413190-413212 CCATAGAGGGCCAGGATCCCCGG - Intergenic
1160681437 19:413264-413286 CCATAGAGGGCCAGGATCCCCGG - Intergenic
1160681462 19:413338-413360 CCATAGAGGGCCAGGATCCCCGG - Intergenic
1161088289 19:2344928-2344950 CTTGCTGGGGCCTGGATCCCGGG + Intronic
1161357575 19:3827470-3827492 CCTTCTGGTGCTTGGATCCCCGG + Exonic
1162630440 19:11923475-11923497 GGCTCTAGGGCCCGGAGCCCGGG - Intergenic
1162635362 19:11963754-11963776 GGATCTAGGGCCCGGAGCCCGGG - Intronic
1164672069 19:30077881-30077903 CCATCTGGGGCCGGGATGCCTGG + Intergenic
1166078062 19:40425498-40425520 CCTTCTACTGCCCCGATTCCCGG + Intronic
1167597784 19:50436409-50436431 ACTTCTGGGGCCCAGGTCCCTGG - Intronic
1168713460 19:58514385-58514407 CCTGCTAGGTCCAGGAGCCCAGG - Intronic
929072531 2:38048313-38048335 TCTTCTGGGGCCCATATCCCAGG - Intronic
929870575 2:45755694-45755716 CCTCCTAGGGCCCGGCTCTGTGG + Intronic
934736187 2:96691103-96691125 CCCTCTAGGGCCTGTCTCCCGGG + Intergenic
941438720 2:165506531-165506553 CCTTCTGGGAGCCGAATCCCTGG - Intronic
948425792 2:237885946-237885968 TCTTCGAGGACCCGGCTCCCAGG - Intronic
948449556 2:238060804-238060826 GCTTCTAGCGCCCGGTTCCCGGG + Intronic
949027789 2:241774471-241774493 GCTTCTAGGTCTCAGATCCCGGG - Intergenic
1170656312 20:18290160-18290182 CCAGCTGGGGCCCTGATCCCTGG - Intronic
1171122388 20:22578386-22578408 CCTTCCAGGGCTCGGACGCCCGG - Intergenic
1173648912 20:44650987-44651009 CCTGCTAGGGCCCCAAACCCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175610762 20:60349316-60349338 CCTTCTGGGGCCCGCTTTCCTGG + Intergenic
1176105046 20:63381969-63381991 GCTTCTGGGGCCCGGCTCTCCGG - Intergenic
1176239209 20:64068113-64068135 CCTCAGAGGCCCCGGATCCCAGG + Exonic
1177279463 21:18961959-18961981 CGTACTAGGGCCTGGAGCCCAGG - Intergenic
1179400150 21:41076021-41076043 CCTTCTGGGGCCCAGACCTCAGG + Intergenic
1181493601 22:23275630-23275652 CCTTCTGGGGCCCTGAGCCAGGG - Intronic
1182423459 22:30259748-30259770 CCTTCCAGGGTCTGGATCCCTGG - Intergenic
1183487723 22:38098243-38098265 ACTTCCAGGGCCCTGATCTCTGG - Intronic
1184791550 22:46703397-46703419 CCTTCTAGCGGCTGGAACCCTGG + Intronic
949297553 3:2543457-2543479 CCTCCCAGGGCCCAAATCCCAGG - Intronic
965682361 3:171264619-171264641 CTTTCTAAGGCCCCCATCCCGGG + Intronic
972801801 4:42483545-42483567 CCTTCTAGGGACCTGGTGCCTGG + Intronic
978429835 4:108622097-108622119 CTTTCTAGGTCCCGAACCCCTGG + Exonic
978558619 4:110007872-110007894 GCTTTTAGGTCACGGATCCCTGG - Intronic
988482203 5:31639753-31639775 CCTGCTCGGGCGCGCATCCCGGG + Intronic
995109965 5:108418121-108418143 CCTTCTGGGGCCCAGACCTCGGG + Intergenic
1002762277 6:211196-211218 CATTCTAGGGCCAGGAGCGCGGG + Intergenic
1003490940 6:6620967-6620989 CCTTCGAGGGCCCACATGCCCGG + Intronic
1009687849 6:66986774-66986796 CGTTCCAGGGCCTAGATCCCAGG - Intergenic
1017714686 6:157200823-157200845 CCTACTCGGGCCCGGACCGCAGG + Exonic
1017906190 6:158758838-158758860 CCTTCCAGGACCCGGAGCTCAGG + Intronic
1019463576 7:1174248-1174270 CCATCCAGGGCCAGGAACCCGGG + Intergenic
1019915162 7:4128467-4128489 CCTTCCAGGTCCCCGATCTCAGG + Intronic
1023856504 7:44187400-44187422 TCTTCTAGTGCCTGGATCGCAGG - Intronic
1023881317 7:44323179-44323201 CCTGCTAGGCGCCGGGTCCCTGG - Intronic
1024981585 7:55161541-55161563 GCTGCTGGGGCCCGGAGCCCAGG + Exonic
1026541264 7:71281960-71281982 CCTACTAGGGCCCAGGTCACAGG + Intronic
1028207597 7:88034332-88034354 CATTCCAGGGCCCAGCTCCCAGG - Intronic
1033392129 7:140938303-140938325 ACTTCTAGGCCCCTGATCACCGG - Intergenic
1044666711 8:94640355-94640377 CCTTCTCCGGGCCGGAGCCCGGG - Intergenic
1049620095 8:143594275-143594297 CCTTCCAGAGCCAGGACCCCAGG - Intronic
1053421673 9:37983758-37983780 GCGTCTCGGGCACGGATCCCCGG - Intronic
1053445849 9:38152646-38152668 CCTTCTAGTACCAGGAGCCCAGG + Intergenic
1061160591 9:128891782-128891804 TCTTCAAGGGCCTGGGTCCCAGG + Intronic
1062494525 9:136825466-136825488 CCCTCCAGGGCCCCGATCCTGGG - Intronic
1185611393 X:1395486-1395508 CCTGCTTGGGCCTGGCTCCCAGG + Intergenic
1186681137 X:11875596-11875618 CCTTCTAGGGGCTGGATTCTAGG - Intergenic
1191104567 X:56764472-56764494 CCTTCAAGGGCTCAGAACCCCGG + Intergenic
1192261061 X:69505984-69506006 CCTCCCAGGCCCCGGAGCCCGGG - Exonic
1194583515 X:95705331-95705353 CATTCTAGGCCCTAGATCCCAGG + Intergenic