ID: 1137670286

View in Genome Browser
Species Human (GRCh38)
Location 16:50274557-50274579
Sequence TCGGGTTCTCAGGAAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 659}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137670273_1137670286 10 Left 1137670273 16:50274524-50274546 CCCTCTGTGTCTCTCGTGCCCCC 0: 1
1: 0
2: 1
3: 27
4: 389
Right 1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG 0: 1
1: 0
2: 4
3: 66
4: 659
1137670272_1137670286 11 Left 1137670272 16:50274523-50274545 CCCCTCTGTGTCTCTCGTGCCCC 0: 1
1: 0
2: 0
3: 38
4: 551
Right 1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG 0: 1
1: 0
2: 4
3: 66
4: 659
1137670280_1137670286 -9 Left 1137670280 16:50274543-50274565 CCCCTAGGCCTGGATCGGGTTCT 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG 0: 1
1: 0
2: 4
3: 66
4: 659
1137670274_1137670286 9 Left 1137670274 16:50274525-50274547 CCTCTGTGTCTCTCGTGCCCCCT 0: 1
1: 0
2: 1
3: 35
4: 406
Right 1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG 0: 1
1: 0
2: 4
3: 66
4: 659
1137670279_1137670286 -8 Left 1137670279 16:50274542-50274564 CCCCCTAGGCCTGGATCGGGTTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG 0: 1
1: 0
2: 4
3: 66
4: 659
1137670281_1137670286 -10 Left 1137670281 16:50274544-50274566 CCCTAGGCCTGGATCGGGTTCTC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG 0: 1
1: 0
2: 4
3: 66
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137670286 Original CRISPR TCGGGTTCTCAGGAAGCCTC GGG Intronic
900501384 1:3006590-3006612 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
900586386 1:3434395-3434417 GCGGGTTCCCAGGCAGACTCGGG - Exonic
900907768 1:5572742-5572764 TCGGCTCCTGGGGAAGCCTCAGG - Intergenic
900937433 1:5775407-5775429 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
901276646 1:7996747-7996769 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
901916668 1:12505561-12505583 TGGGGTGCTCAGGAAGACACGGG + Intronic
902091949 1:13910606-13910628 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
902545253 1:17185823-17185845 TCTGGTCCTCAGGAAGCCTCTGG - Intergenic
902957058 1:19932721-19932743 TCTGCTTCTCAGGAGGCCTCAGG - Intergenic
902972222 1:20062100-20062122 TCGGCTTCTAGGGAGGCCTCAGG - Intronic
902996024 1:20225818-20225840 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
903561837 1:24233871-24233893 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
904314705 1:29652701-29652723 TCTGCTTCTAGGGAAGCCTCTGG + Intergenic
904437913 1:30511281-30511303 TCGGCTTCTGGGGAAGCCTCAGG - Intergenic
904466309 1:30709948-30709970 GCAGGTTCTCAGGAAGCATTTGG + Intergenic
905537566 1:38735145-38735167 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
905813665 1:40931409-40931431 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
905899133 1:41569091-41569113 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
907486404 1:54781204-54781226 GCGGGGTCCCAGGGAGCCTCCGG + Exonic
907625413 1:56024559-56024581 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
907984679 1:59518749-59518771 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
909491027 1:76226599-76226621 TGTGGTTCTGAGGAGGCCTCAGG + Intronic
909580210 1:77224849-77224871 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
910037506 1:82805524-82805546 TGGAGTTCTCAGGAAGCTTGCGG + Intergenic
910378149 1:86595646-86595668 TCTGCTTCTAGGGAAGCCTCAGG + Intergenic
910839875 1:91550714-91550736 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
911339714 1:96621720-96621742 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
911488222 1:98528665-98528687 TCAGCTTCTGAGGAAGCCTCAGG - Intergenic
914857576 1:151363740-151363762 CCGGCTTCTCAGGAGGCCTCAGG - Intergenic
915933295 1:160073920-160073942 TCAGCTTCTCAGGAGACCTCAGG - Intergenic
916031107 1:160878268-160878290 TCGGCTTCTGGGAAAGCCTCAGG - Intronic
916251423 1:162742367-162742389 TTGGCTTCTGAGGAGGCCTCAGG + Intronic
916456408 1:164975205-164975227 TCTGATACTCAGGATGCCTCGGG - Intergenic
916752790 1:167738790-167738812 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
917516491 1:175712775-175712797 TCAGTTTCTCGGGAGGCCTCAGG - Intronic
917700236 1:177573369-177573391 TCAGCTTCTGAGGAAGCCTCAGG + Intergenic
918276586 1:182958893-182958915 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
918390526 1:184055142-184055164 TCGGCTTCTAGGGAGGCCTCAGG + Intronic
918863049 1:189858489-189858511 TCAGCTTCTGATGAAGCCTCAGG + Intergenic
919096699 1:193045548-193045570 TCGGCTTCTTGGGAGGCCTCAGG - Intronic
919162948 1:193854623-193854645 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
919235597 1:194838183-194838205 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
919566569 1:199196005-199196027 TCAGTTTCTGAGGAGGCCTCAGG - Intergenic
919800840 1:201353778-201353800 GCTGGTGCTCAGGAAGCCCCAGG + Intergenic
920553159 1:206882067-206882089 TTGGCTTCTCGGGAGGCCTCAGG - Intergenic
921510489 1:216022107-216022129 TCTGATTCTGAGGAGGCCTCAGG - Intronic
922005102 1:221522343-221522365 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
922119503 1:222649852-222649874 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
922719368 1:227892550-227892572 CCGGGTAGTCAGGAAGCCCCTGG + Intergenic
923097301 1:230785618-230785640 TCTGCTTCTAAGGAGGCCTCAGG - Intronic
923238866 1:232061214-232061236 TCAGCTTCTCATGAGGCCTCAGG - Intergenic
923964044 1:239116360-239116382 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
924145164 1:241066869-241066891 TTTGGTTGTCAAGAAGCCTCTGG + Intronic
924287524 1:242503382-242503404 TCGGCTTCTGAGGAGGCCTCAGG - Intronic
1063225892 10:4014188-4014210 TCGGTTTCTGAGTCAGCCTCAGG + Intergenic
1063545448 10:6976543-6976565 TCAGGTTCTGGGGAGGCCTCAGG - Intergenic
1063735333 10:8747283-8747305 TTGGGTTCTCAGGACCTCTCTGG + Intergenic
1063842093 10:10083445-10083467 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1063972275 10:11389403-11389425 TCCTGTTCTCAGGAAGCTTGGGG + Intergenic
1064432251 10:15281198-15281220 TCTGCTTCTGGGGAAGCCTCAGG - Intronic
1064572010 10:16703139-16703161 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1065049125 10:21772866-21772888 TTGGCTTCTGGGGAAGCCTCAGG + Intronic
1065678932 10:28209084-28209106 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1065870537 10:29952621-29952643 TCAGCTTCTAGGGAAGCCTCAGG + Intergenic
1065915559 10:30351831-30351853 TCTGCTTCTGAGGAAGCCTCGGG - Intronic
1066295759 10:34052880-34052902 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1066484002 10:35826188-35826210 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1068224408 10:54088002-54088024 TCTGCTTCTGGGGAAGCCTCAGG - Intronic
1068461362 10:57333722-57333744 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1068542389 10:58309722-58309744 TCGGCTTCTGAGGCAGGCTCAGG - Intergenic
1069106255 10:64386324-64386346 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1069202388 10:65637068-65637090 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1070109172 10:73465638-73465660 TCAGCCTTTCAGGAAGCCTCTGG + Intronic
1070413075 10:76162506-76162528 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1071028746 10:81146426-81146448 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1071203787 10:83251563-83251585 TCAGCTTCTGATGAAGCCTCAGG + Intergenic
1071242817 10:83727243-83727265 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
1071390982 10:85175108-85175130 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
1071667079 10:87568851-87568873 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
1071705918 10:87998339-87998361 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1072452044 10:95546397-95546419 TCGGCTTCTAGGGAGGCCTCAGG + Intronic
1072951054 10:99846968-99846990 TCCTGTTCTCTGGAAGCCTGAGG + Exonic
1072972292 10:100027866-100027888 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1073784452 10:106873195-106873217 TCAGGTACTCAGGAAGGCTGAGG + Intronic
1074046061 10:109840341-109840363 TGGGGTTCTCAGGGATCTTCTGG - Intergenic
1074260765 10:111851212-111851234 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1074969663 10:118525709-118525731 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
1075549597 10:123382457-123382479 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1075838467 10:125476629-125476651 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1075927726 10:126266705-126266727 TCGGCTTCTGAGGAGGCCTCAGG + Intronic
1076462036 10:130654426-130654448 TGGGGTTCTCAGGAGTCCTCAGG - Intergenic
1077280177 11:1741024-1741046 TCTGCTTCTGGGGAAGCCTCAGG - Intronic
1077431542 11:2518251-2518273 CCAGGCTCTCAGGAGGCCTCCGG - Intronic
1077503600 11:2920132-2920154 TCGGCCTCTCCGGAAGCCTGTGG + Intronic
1077549141 11:3192168-3192190 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1078134682 11:8641917-8641939 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1078337416 11:10475111-10475133 TCTGCTTCTGAGGAAGCCTCAGG + Intronic
1079173390 11:18117164-18117186 TCTGCTTCTGGGGAAGCCTCAGG - Intronic
1079270060 11:18976185-18976207 TCTGCTTCTAAGGAGGCCTCAGG + Intergenic
1079546006 11:21632538-21632560 TCTGGCTCTCAAGAAGCCTTAGG + Intergenic
1079637751 11:22765873-22765895 TCTGCTTCTCAGGAGGCCTCAGG + Intronic
1079958593 11:26894498-26894520 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
1079980693 11:27149033-27149055 TTGGCTTCTGAGGAAGCCTCAGG + Intergenic
1080061086 11:27957591-27957613 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1080136061 11:28856690-28856712 TCTGCTTCTGAGGAAGCCTCAGG + Intergenic
1080173821 11:29338501-29338523 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
1081571436 11:44293870-44293892 CCTGGTTCTCAGGATGGCTCTGG + Intronic
1081751807 11:45516596-45516618 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
1082644810 11:55709493-55709515 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
1082733236 11:56825662-56825684 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1083128088 11:60593136-60593158 TCGGCTTCTGAAGAGGCCTCAGG + Intergenic
1085698595 11:78726791-78726813 TCTGCTTCTGGGGAAGCCTCAGG - Intronic
1085882518 11:80484696-80484718 TAGGCTTCTTGGGAAGCCTCAGG + Intergenic
1086247375 11:84770222-84770244 TCAGCTTCTGAGGAGGCCTCAGG - Intronic
1086286645 11:85259338-85259360 TCTGCTTCTCGGGAGGCCTCAGG - Intronic
1086509897 11:87544761-87544783 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1086862763 11:91944439-91944461 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1087165650 11:94999835-94999857 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1087403269 11:97695192-97695214 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1087431599 11:98063370-98063392 TCTGCTTCTAAGGAAGCCTCAGG + Intergenic
1087738557 11:101861640-101861662 TCAGCTTCTGAGGAGGCCTCAGG + Intronic
1089821210 11:121227872-121227894 TCGGCTTCTAGGGAGGCCTCAGG + Intergenic
1089896492 11:121935466-121935488 TCAGGTTCTGGGGAGGCCTCAGG + Intergenic
1089995441 11:122902616-122902638 TTGGTTTCTAAGGAAACCTCGGG + Intronic
1090005888 11:123001920-123001942 TCCGCTTCTAAGGAGGCCTCAGG - Intergenic
1090106909 11:123863118-123863140 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1090544531 11:127748265-127748287 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1090564329 11:127970679-127970701 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
1090925427 11:131245800-131245822 TCCAGTCCTCAGGAAGCCTGAGG - Intergenic
1091452474 12:581883-581905 TCTGGTTCTCAGGACACCTTGGG - Intronic
1092735289 12:11576722-11576744 TCTGGTTCTGGGGAGGCCTCAGG + Intergenic
1094002344 12:25708268-25708290 TCAGCTTCTAAGGAGGCCTCAGG - Intergenic
1094144087 12:27210784-27210806 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1094322683 12:29202794-29202816 TCTGCTTCTGAGGAAGCCTCAGG - Intronic
1094616891 12:32044007-32044029 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
1094794241 12:33951799-33951821 TCAGCTTCTAGGGAAGCCTCAGG - Intergenic
1095226847 12:39687385-39687407 TTGGCTTCTGGGGAAGCCTCAGG + Intronic
1095309917 12:40686814-40686836 TCGGCTTCTAGAGAAGCCTCAGG + Intergenic
1095409827 12:41909360-41909382 TTAGCTTCTCATGAAGCCTCAGG - Intergenic
1095782829 12:46079059-46079081 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1096190994 12:49619184-49619206 TCCCTTTCTCAGGAAGCTTCTGG + Intronic
1096953357 12:55499508-55499530 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
1098610611 12:72452857-72452879 TTGGCTTCTAGGGAAGCCTCAGG - Intronic
1099360636 12:81695491-81695513 TTGGCTTCTGAAGAAGCCTCAGG - Intronic
1099495806 12:83344336-83344358 TCGGCTTCTTGGGAGGCCTCAGG - Intergenic
1099628851 12:85113799-85113821 TCAGTTTCTCAGGAAACCTGGGG - Intronic
1099860860 12:88223533-88223555 TCTGCTTCTGAGGAAGCCTCAGG - Intergenic
1100170458 12:91969770-91969792 TCAGTTTCTGAGGAGGCCTCAGG + Intergenic
1100337779 12:93648256-93648278 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
1100692572 12:97054163-97054185 TTGGCTTCTGCGGAAGCCTCAGG + Intergenic
1101808382 12:108085414-108085436 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
1102513878 12:113433968-113433990 TCCAATTCTCAGGAGGCCTCTGG + Intronic
1103453876 12:121049567-121049589 TCCGCTTCTGGGGAAGCCTCAGG - Intergenic
1104370086 12:128216632-128216654 TCGGCTTCTGAGGAGGCCTCAGG - Intergenic
1104538118 12:129637726-129637748 TTGGCTTCTGGGGAAGCCTCAGG + Intronic
1104572693 12:129938942-129938964 TCGGCTTCTAGGGAGGCCTCAGG + Intergenic
1104884505 12:132098628-132098650 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1105236871 13:18564904-18564926 TGTGGCTCTCAGGAAGCTTCAGG - Intergenic
1105533152 13:21237987-21238009 TCGGCTTCTAGGGAGGCCTCAGG - Intergenic
1105682438 13:22743277-22743299 TCGACTTCTGAGGAGGCCTCAGG - Intergenic
1105940232 13:25141329-25141351 TCTGGTGCTTAGGAAGCCCCTGG + Intergenic
1106464214 13:29998365-29998387 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1106475768 13:30096749-30096771 TGGGGTCCCCAGGTAGCCTCAGG - Intergenic
1106851150 13:33793937-33793959 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
1107331237 13:39303484-39303506 TCTAGTTCTCTGGAAACCTCCGG - Intergenic
1107516774 13:41136931-41136953 TCAGTTTCTAGGGAAGCCTCAGG - Intergenic
1108005145 13:45938712-45938734 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
1108156478 13:47590565-47590587 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1108770404 13:53693808-53693830 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
1109342847 13:61084017-61084039 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1109611497 13:64771187-64771209 TCTGTTTCTGTGGAAGCCTCTGG - Intergenic
1109843408 13:67951194-67951216 TCGGCTTCTGATGAAGTCTCAGG + Intergenic
1109920496 13:69051800-69051822 TAGGCTTCTAGGGAAGCCTCAGG - Intergenic
1110127762 13:71968261-71968283 TGGGGTACTAAGAAAGCCTCCGG - Intergenic
1110276973 13:73651792-73651814 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1110440706 13:75522203-75522225 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1110574211 13:77037448-77037470 TCTGCTTCTAAGGAGGCCTCAGG - Intergenic
1110852189 13:80258567-80258589 TTGGCTTCTATGGAAGCCTCAGG + Intergenic
1111429086 13:88128756-88128778 TCGGTTTCTAAGTAGGCCTCAGG + Intergenic
1111971927 13:94925713-94925735 TGGGTTTCTCAGGACGCCTTGGG - Intergenic
1112176434 13:97029982-97030004 TCGGCTTCTGGGGAAGTCTCAGG + Intergenic
1112223938 13:97518995-97519017 TTGGGTTCTGGGGAGGCCTCAGG + Intergenic
1112252092 13:97791862-97791884 TCAGCTTCTCAGAAGGCCTCAGG + Intergenic
1112529217 13:100184074-100184096 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1112999048 13:105610878-105610900 TCAGCTTCTCGGGAAGCTTCAGG + Intergenic
1113499437 13:110761489-110761511 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
1113673349 13:112190163-112190185 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1115183799 14:30660951-30660973 TCCGTTTCTCAAAAAGCCTCTGG + Intronic
1115374099 14:32653537-32653559 TCAGCTTCTAAGGAGGCCTCAGG - Intronic
1115715295 14:36097005-36097027 TTGGCTTCTCGGGAGGCCTCAGG + Intergenic
1115936451 14:38558608-38558630 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1116916777 14:50532703-50532725 TTGTGTTCTCAGCAGGCCTCAGG - Intronic
1117941662 14:60973317-60973339 TCTGCTTCTGGGGAAGCCTCAGG + Exonic
1118332260 14:64823715-64823737 GAGGGCTCTCAGAAAGCCTCCGG - Intronic
1118818568 14:69329680-69329702 TTGGCTTCTGAGGAGGCCTCAGG + Intronic
1120146859 14:80988307-80988329 TTGGCTTCTGGGGAAGCCTCAGG + Intronic
1120265759 14:82248710-82248732 TAGGCTTCTCATGAGGCCTCAGG - Intergenic
1120407347 14:84105535-84105557 TCTGCTTCTAAGGAGGCCTCAGG + Intergenic
1120889415 14:89478249-89478271 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1121267162 14:92611888-92611910 TCAGCTTCTGAGGAGGCCTCAGG + Intronic
1121430217 14:93881238-93881260 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
1121830693 14:97049433-97049455 GCATGTTATCAGGAAGCCTCTGG + Intergenic
1202892148 14_KI270722v1_random:168737-168759 TCTGCTTCTAAGGAAGCCTCAGG + Intergenic
1124132192 15:27000715-27000737 TCAGCTTCTAAGGAAGTCTCAGG - Intronic
1124188663 15:27552188-27552210 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1125002446 15:34785518-34785540 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1125337174 15:38638141-38638163 TAGGTTTCTCATGAAGCCTTTGG - Intergenic
1126018300 15:44374588-44374610 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1126120270 15:45245474-45245496 TCAGCTTCTAAGGAGGCCTCAGG + Intergenic
1126203712 15:46018899-46018921 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1128525364 15:68408617-68408639 CTGGGTGCTCAGGAAGCTTCTGG + Intronic
1128539825 15:68518706-68518728 CAGGGTTCCCAGGAAGCCCCTGG - Intergenic
1128672976 15:69588054-69588076 TCTGGATCTCATGTAGCCTCTGG + Intergenic
1129479756 15:75814310-75814332 TCTGCTTCTGAAGAAGCCTCAGG + Intergenic
1129731982 15:77937677-77937699 TAGGCTTCTCGTGAAGCCTCAGG - Intergenic
1129812617 15:78523218-78523240 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1130075685 15:80687411-80687433 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1130904778 15:88232743-88232765 TGGGGTCCTCAGTAGGCCTCTGG - Intronic
1131178443 15:90224572-90224594 TCAGAATTTCAGGAAGCCTCAGG + Intronic
1131520913 15:93114223-93114245 TCAGCTTCTAAGGAAGCCTCAGG - Intergenic
1134863724 16:17585549-17585571 TCTGGTTCTAAGGAGGCCTCAGG + Intergenic
1135055576 16:19229322-19229344 TTGGCTTCCCAGGAGGCCTCAGG + Intronic
1135991769 16:27222886-27222908 CTGGGGACTCAGGAAGCCTCTGG - Intergenic
1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG + Intronic
1138292045 16:55856091-55856113 TCAGCTTCTCGGGAGGCCTCAGG - Intronic
1138350253 16:56342527-56342549 GCTGGTTCTCAGGTAGGCTCAGG - Intronic
1138747132 16:59376520-59376542 TCTGCTTCTCATGAGGCCTCAGG + Intergenic
1138795860 16:59968222-59968244 TCGGCTTCTGAGGAGGCTTCAGG + Intergenic
1139041710 16:63006041-63006063 TTGGCTTCTCGGGAGGCCTCAGG + Intergenic
1139106405 16:63831806-63831828 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
1139316330 16:66072690-66072712 TCGGCTTCTAGGGAGGCCTCAGG + Intergenic
1140467130 16:75191523-75191545 TCAGCTTCTCGGGAGGCCTCGGG + Intergenic
1140557339 16:75936815-75936837 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1140947239 16:79780593-79780615 TTGAGTTCTCATGGAGCCTCTGG + Intergenic
1141665814 16:85464607-85464629 CAGGGTACTCACGAAGCCTCGGG + Intergenic
1141764742 16:86051117-86051139 TCGGGCTCTCAGCAGGCCCCAGG - Intergenic
1142807509 17:2379280-2379302 GAGGGTTCTCAGGAATCCTGGGG + Intronic
1143402901 17:6657418-6657440 TGGGGGTGTCAGGAGGCCTCTGG + Intergenic
1143916105 17:10294623-10294645 ACAGGTTCTGGGGAAGCCTCAGG + Intergenic
1145000839 17:19303514-19303536 TCCGGTTCTCAGGAAGCTCAGGG - Intronic
1145026737 17:19473464-19473486 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1146523883 17:33549402-33549424 TAGGGTTCTCAAGAATCATCAGG + Intronic
1147038872 17:37701954-37701976 CCGGGTTCTAAAGAGGCCTCAGG - Intronic
1147540963 17:41359247-41359269 TCTGCTTCTAGGGAAGCCTCAGG + Intergenic
1147925047 17:43940995-43941017 TCGTGCCCTCAGGAGGCCTCAGG + Intronic
1149433976 17:56617904-56617926 TGGGGTTCTGAAGCAGCCTCTGG - Intergenic
1149484126 17:57028688-57028710 TCGGCTTCTTGGGAGGCCTCAGG - Intergenic
1150938115 17:69659632-69659654 TTGGCTTCTCGTGAAGCCTCAGG + Intergenic
1151039685 17:70844204-70844226 TCTGCTTCTCATGAGGCCTCAGG + Intergenic
1151120581 17:71788582-71788604 TTGGCTTCTAAGGAGGCCTCAGG + Intergenic
1152547714 17:81010415-81010437 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1152919842 17:83060732-83060754 TCTGCTTCTGAGGAGGCCTCGGG - Intergenic
1153082022 18:1238375-1238397 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1153104786 18:1513973-1513995 TCGGCTTCTGAGGAGGTCTCAGG + Intergenic
1153170229 18:2307943-2307965 TCAGCTTCTCAGGAGGCCTCAGG - Intergenic
1153171400 18:2320008-2320030 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1153350057 18:4069663-4069685 TCAGCTTCTGGGGAAGCCTCAGG - Intronic
1153435661 18:5065357-5065379 TCGGCTTCTGAGGAGGCCTGAGG - Intergenic
1153601826 18:6788312-6788334 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1153937475 18:9942639-9942661 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1153954029 18:10080920-10080942 TCGGCTTCTAAGGAGGCCACTGG - Intergenic
1154372097 18:13773685-13773707 TTGGCTTCTCAGGAAGCCTCAGG + Intergenic
1154508561 18:15068779-15068801 TCTGTTTCTGGGGAAGCCTCAGG + Intergenic
1154512671 18:15125010-15125032 TGTGGCTCTCAGGAAGCTTCAGG + Intergenic
1155727023 18:29099360-29099382 TCGGCTTCTAGGGATGCCTCAGG - Intergenic
1156068380 18:33174080-33174102 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1156814961 18:41298557-41298579 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1156907653 18:42373471-42373493 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1157152964 18:45237759-45237781 TCAGCCTCTCAGGAAGGCTCTGG - Intronic
1157989577 18:52478618-52478640 TCAGCTTCTGGGGAAGCCTCAGG + Intronic
1157999039 18:52594673-52594695 TCTGGTTCTGGGGAGGCCTCAGG + Intronic
1158790865 18:60778850-60778872 TCTGATTCTGGGGAAGCCTCAGG - Intergenic
1158861211 18:61594044-61594066 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1159695770 18:71554235-71554257 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
1159866162 18:73707821-73707843 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
1160272921 18:77403886-77403908 GGGAGTTCTCAGGAAGCTTCTGG + Intergenic
1160557932 18:79738115-79738137 ACGCTTTCTCAGGAAGCTTCTGG - Intronic
1160944138 19:1633365-1633387 CCTGGCTCTCGGGAAGCCTCTGG - Intronic
1161555691 19:4941432-4941454 ACGGGTTCTCGGGATGCCTGGGG - Intronic
1161764629 19:6199893-6199915 TCTGGCTCTCAGGCAGCCTCAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163195238 19:15714781-15714803 TCTGGTTCTGAGGAGCCCTCGGG + Intergenic
1163219092 19:15901563-15901585 TCTGGTTCTGGGGAGGCCTCAGG - Intergenic
1164448401 19:28337331-28337353 AAGGGTCTTCAGGAAGCCTCAGG - Intergenic
1164584521 19:29458417-29458439 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1164687771 19:30179830-30179852 TCAGCTTCTGAGGAAGCCTCAGG + Intergenic
1164950238 19:32330918-32330940 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1165004756 19:32795765-32795787 TCGGCTTCTGCGGAAGCCTCAGG + Intronic
1165308563 19:35017188-35017210 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1165426812 19:35750408-35750430 TGGGCTTCTCAGGAAGTCCCTGG + Intronic
1166560303 19:43728393-43728415 TCGGCTTCTGGGGAGGCCTCAGG - Exonic
1166903338 19:46084588-46084610 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
925061650 2:896067-896089 TCTGGTTCTGAGGAGGCCTCAGG - Intergenic
925140017 2:1543871-1543893 TCGGCTTCTGGGGAGGCCTCTGG + Intergenic
925998091 2:9308215-9308237 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
926467100 2:13204996-13205018 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
926610567 2:14942499-14942521 TTAGCTTCTGAGGAAGCCTCAGG - Intergenic
926925240 2:17980687-17980709 TCGGCTTCTCAGGAGGCCTCAGG - Intronic
927003765 2:18826447-18826469 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
927395684 2:22648265-22648287 TCTGTTTCTAAGGAGGCCTCAGG - Intergenic
927397137 2:22665438-22665460 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
927838027 2:26416895-26416917 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
927928729 2:27030596-27030618 TCTGCTTCTAGGGAAGCCTCAGG + Intergenic
928224080 2:29432408-29432430 TCGGCTTCTGATGAGGCCTCAGG - Intronic
928231227 2:29500406-29500428 TTGGCTTCTCAGGAGGCCTGAGG - Intronic
928961700 2:36932933-36932955 TCGAGTTCTGAGGGAGCCTTTGG - Intronic
929329144 2:40658563-40658585 TCTGCTTCTCCAGAAGCCTCAGG - Intergenic
930867238 2:56133884-56133906 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
931369854 2:61651969-61651991 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
932325731 2:70860328-70860350 TCAGCTTCTGATGAAGCCTCAGG - Intergenic
933183629 2:79254537-79254559 TCTGCTTCTGGGGAAGCCTCGGG - Intronic
933458037 2:82541976-82541998 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
933724937 2:85421261-85421283 TCTGGTTCTCTGGATACCTCTGG - Intronic
934922193 2:98353787-98353809 TCAGCTTCTTGGGAAGCCTCAGG + Intronic
935234666 2:101128406-101128428 TAGGGTACTCAGGAAGCCAGGGG + Intronic
935241396 2:101181360-101181382 TTGGCTTCTGAGGAGGCCTCAGG + Intronic
935349266 2:102139779-102139801 TGGGCTTCTGAGGAGGCCTCAGG - Intronic
936407658 2:112221423-112221445 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
936734547 2:115425818-115425840 TCAGCTTCTGAGGAGGCCTCAGG + Intronic
937247077 2:120500421-120500443 GTGGGTTCTCAGGCAGCCTGTGG + Intergenic
937966428 2:127514945-127514967 TCCGGTTGGCAGGAAACCTCTGG - Intronic
938512914 2:131969645-131969667 TGTGGCTCTCAGGAAGCTTCAGG + Intergenic
939371065 2:141300750-141300772 TCTGATTCTGAGGAGGCCTCAGG - Intronic
940425830 2:153531264-153531286 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
941216427 2:162715193-162715215 TCTGTTTCTGGGGAAGCCTCAGG + Intronic
941378903 2:164766544-164766566 TCAGATTCTAGGGAAGCCTCAGG - Intronic
941431980 2:165424073-165424095 TTGGTTTCTGAGGAGGCCTCAGG + Intergenic
942131101 2:172880236-172880258 TGGGGAGCTCAGGAAGCCTAGGG + Intronic
943004945 2:182377385-182377407 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
943343434 2:186709007-186709029 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
943687046 2:190829682-190829704 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
944187733 2:196968009-196968031 TCAGCTTCTAGGGAAGCCTCAGG - Intronic
944230179 2:197384602-197384624 TTGGGTTCTGGGGAGGCCTCAGG - Intergenic
944785962 2:203070643-203070665 TCTGCTTCTGGGGAAGCCTCAGG + Intronic
945122227 2:206468856-206468878 TCTGCTTCTGGGGAAGCCTCAGG + Intronic
945515999 2:210763847-210763869 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
946876878 2:224138393-224138415 TAGGCTTCTGAGGAGGCCTCAGG + Intergenic
946984493 2:225256950-225256972 TCTGCTTCTGAGGAGGCCTCTGG + Intergenic
947050309 2:226035143-226035165 TTGGCTTCTGAGGAAGCCTCGGG + Intergenic
947052741 2:226064737-226064759 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
947818085 2:233051491-233051513 ACTGGGTCTCAGGAAGCCCCAGG - Intergenic
948003532 2:234589027-234589049 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
948312526 2:236999423-236999445 TCAGTTTCTGGGGAAGCCTCAGG - Intergenic
948795242 2:240399200-240399222 CAGGGGTCTCGGGAAGCCTCCGG + Intergenic
1168976233 20:1968219-1968241 TCGGCTTCTAGGGAGGCCTCAGG - Intergenic
1169148838 20:3273463-3273485 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1169467237 20:5852086-5852108 TAGGCTTCTAAGGAGGCCTCAGG - Intronic
1169680334 20:8204641-8204663 TTGGCTTCTGGGGAAGCCTCAGG - Intronic
1169681074 20:8214468-8214490 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1170121979 20:12921813-12921835 TCTGCTTCTGAGGAAGCCTCAGG - Intergenic
1170377230 20:15713454-15713476 TCTGCTTCTGAGAAAGCCTCAGG + Intronic
1170456564 20:16538990-16539012 TCTGCTTCTCAGGAGGCCTCAGG - Intronic
1170560028 20:17549364-17549386 TCTGCTTCTGGGGAAGCCTCAGG + Intronic
1170560269 20:17551230-17551252 TCGGCTTCTGAGGAGGCCTCAGG + Intronic
1170814071 20:19698017-19698039 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1171302431 20:24075427-24075449 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1171862194 20:30411542-30411564 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1172655038 20:36531704-36531726 TAGGGTTCTCAGGGACCCACAGG - Intergenic
1173365469 20:42380921-42380943 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1173773043 20:45680426-45680448 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1173934058 20:46845903-46845925 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1174561580 20:51434297-51434319 ACAGTTTCTCAGGGAGCCTCTGG - Intronic
1175043204 20:56075793-56075815 TCTGCTTCTAAGGAGGCCTCAGG - Intergenic
1175046838 20:56114799-56114821 TCAGGTTCTCAGGAGGACTCAGG + Intergenic
1175213454 20:57376104-57376126 TCGGGGCCTCAGGGAGACTCAGG - Intronic
1175882315 20:62267527-62267549 CCGGGCTCTCAGGAGGCCACCGG + Intronic
1175958070 20:62621485-62621507 TCATGTTCCCAGGAAGCCCCTGG + Intergenic
1176049488 20:63110152-63110174 TCAGCTTCTGAGGAGGCCTCGGG + Intergenic
1176387184 21:6144109-6144131 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1176780857 21:13193189-13193211 TGTGGCTCTCAGGAAGCTTCAGG - Intergenic
1176789519 21:13302950-13302972 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
1177696614 21:24581152-24581174 TCTGCTTCTGAGGACGCCTCAGG - Intergenic
1177696883 21:24584992-24585014 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
1177762229 21:25414926-25414948 TGGGCTTCTGGGGAAGCCTCAGG + Intergenic
1177988680 21:28011144-28011166 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
1178368866 21:32010500-32010522 TCAGCTTCTGGGGAAGCCTCGGG + Intronic
1179424519 21:41264502-41264524 TCTGCTTCTCGGGAGGCCTCAGG + Intronic
1179550243 21:42139261-42139283 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1179736289 21:43394143-43394165 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1180336438 22:11580608-11580630 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1183265615 22:36823485-36823507 GCCGGATCTCAGGAAGCCTGTGG + Intergenic
1183274119 22:36880840-36880862 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1183288072 22:36980454-36980476 TCTGCTTCTAGGGAAGCCTCAGG + Intergenic
1184365287 22:44047212-44047234 TCTGGTTCTGGGGAGGCCTCAGG + Intronic
1184838694 22:47039823-47039845 TCGGCTTCTGAGGAGGCCTCAGG + Intronic
1184969875 22:48010476-48010498 TCTGCTTCTCAGGAGACCTCAGG + Intergenic
950201088 3:11044546-11044568 TCGGTTTCTGATGAGGCCTCAGG - Intergenic
950308257 3:11933601-11933623 TCAGCTTCTCGGGAGGCCTCAGG + Intergenic
950827898 3:15844934-15844956 TCTGCTTCTGGGGAAGCCTCAGG + Intronic
951673194 3:25207924-25207946 TTGGGTTCTGAAGAGGCCTCAGG + Intronic
953709782 3:45260273-45260295 TCGGCTTCTGATGAGGCCTCAGG - Intergenic
953982446 3:47419494-47419516 TCTGGTTCTCAGGTAGCTTAGGG + Exonic
954148542 3:48646241-48646263 CGGGGTTCTGAGGAAGCCTGGGG + Exonic
954926009 3:54235360-54235382 TCGGCTTCTGGGGAGGCCTCGGG + Intronic
954999985 3:54918713-54918735 TGTGGTTCTCAGGAGGCCTCAGG + Exonic
955130299 3:56159174-56159196 TTGGCTTCTGAGGAGGCCTCAGG - Intronic
955601875 3:60654144-60654166 TCGGCTTCTAGGGAGGCCTCAGG - Intronic
955636520 3:61036116-61036138 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
956004430 3:64763368-64763390 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
956214433 3:66833850-66833872 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
956327734 3:68071767-68071789 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
957026670 3:75190217-75190239 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
957129768 3:76208097-76208119 TCGGCTTCTGGGAAAGCCTCAGG - Intronic
957610030 3:82453906-82453928 TCGGCTTCTGGGGAAGCCTCAGG - Intergenic
957843219 3:85698501-85698523 TCTGCTTCTGGGGAAGCCTCAGG + Intronic
958101725 3:89020160-89020182 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
958893292 3:99804134-99804156 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
959043553 3:101446218-101446240 TCTGTTTCTGGGGAAGCCTCAGG - Intronic
959301483 3:104607802-104607824 TTGGCTTCTCGGGAGGCCTCAGG - Intergenic
959769084 3:110071377-110071399 TCTGCTTCTGCGGAAGCCTCAGG - Intergenic
960256614 3:115517463-115517485 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
960502760 3:118457012-118457034 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
960536442 3:118820050-118820072 TGGAGTTCTCAGGATCCCTCAGG - Intergenic
960722438 3:120638134-120638156 TCTGTTTCTAATGAAGCCTCAGG - Intronic
960785629 3:121370453-121370475 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
961656738 3:128446671-128446693 TCGGTTTCTGGGGAGGCCTCAGG - Intergenic
962194389 3:133348420-133348442 TTGGTTTCTCAGGAAACCTTGGG + Intronic
962657753 3:137565795-137565817 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
962716208 3:138128372-138128394 TTGGCTTCTGAGGAGGCCTCAGG + Intronic
963261487 3:143195979-143196001 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
963470787 3:145739167-145739189 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
964831832 3:160892239-160892261 TTGGCTTCTGGGGAAGCCTCAGG + Intronic
965090430 3:164155523-164155545 TCAGCTTCTGAGGAAGCCTTAGG + Intergenic
965653242 3:170955466-170955488 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
965756690 3:172034811-172034833 TCTGCTTCTGGGGAAGCCTCGGG + Intergenic
965805371 3:172536358-172536380 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
965856173 3:173090332-173090354 TTGGCTTCTGGGGAAGCCTCTGG - Intronic
965990291 3:174810029-174810051 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
967014317 3:185467890-185467912 TCAGCTTCTCGGGAGGCCTCAGG + Intronic
967206781 3:187130586-187130608 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
967386107 3:188912660-188912682 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
967673543 3:192268686-192268708 TTGGTTTCTAGGGAAGCCTCAGG - Intronic
967688625 3:192446863-192446885 TAGGGATCTCAGGAAGACTGAGG - Intronic
967692539 3:192493621-192493643 TCGGTTTCTGGGGAGGCCTCAGG + Intronic
967857511 3:194129580-194129602 CAGGGACCTCAGGAAGCCTCTGG - Intergenic
968717987 4:2175924-2175946 TCTGCTTCCCAGGAAGACTCTGG + Intronic
969154076 4:5194748-5194770 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
969168765 4:5341737-5341759 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
969828325 4:9775708-9775730 TTGGCTTCTAAGGAGGCCTCAGG - Intronic
970487728 4:16541390-16541412 TTGGCTTCTGAGGAGGCCTCAGG - Intronic
970661402 4:18289838-18289860 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
970855939 4:20649534-20649556 TCAGCTTCTCAGGAGGCCTTAGG - Intergenic
971014476 4:22473178-22473200 TCGGCTTCTAAGGAGGCCTCAGG - Intronic
972061696 4:34882584-34882606 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
972135304 4:35885581-35885603 TTGGGTTTTTGGGAAGCCTCAGG - Intergenic
972149402 4:36070014-36070036 TTGGCTTCTCGGGAAGCCTTAGG - Intronic
972911672 4:43824104-43824126 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
973608119 4:52607833-52607855 TTGGCTTCTGAGGAAGCCTCAGG - Intronic
973628860 4:52799831-52799853 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
973953132 4:56037632-56037654 TCTGCTTCTGAGGAAGCTTCAGG + Intergenic
974339033 4:60589716-60589738 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
975378295 4:73670323-73670345 CCGGGTTCCCTTGAAGCCTCAGG - Intergenic
975860358 4:78670520-78670542 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
976011594 4:80495787-80495809 TCAGCTTCTAAGGAGGCCTCAGG + Intronic
976179634 4:82386899-82386921 TGGGTTTCTCAGGAGTCCTCAGG - Intergenic
976453406 4:85218388-85218410 TCACCTTCTAAGGAAGCCTCTGG - Intergenic
976510561 4:85904209-85904231 TCTGCTTCTAAGGAGGCCTCAGG + Intronic
976798116 4:88957403-88957425 TCAGCTTCTAGGGAAGCCTCAGG - Intronic
976798396 4:88959557-88959579 TGGGCTTCTCGGGAAGCCTCAGG - Intronic
977226422 4:94397611-94397633 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
978024897 4:103861000-103861022 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
978266912 4:106838427-106838449 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
978353921 4:107850201-107850223 CTTGCTTCTCAGGAAGCCTCAGG - Intronic
978540034 4:109806491-109806513 TCCGGTTCTGGGGAGGCCTCAGG - Intergenic
978560561 4:110029360-110029382 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
979100400 4:116605043-116605065 TCTGCTTCTGAGGAAGCCTCAGG + Intergenic
979253680 4:118590488-118590510 TCGGCTTCTGGGGAGGCCTCGGG - Intergenic
979264015 4:118680949-118680971 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
981194501 4:141902906-141902928 TCGGCTTCTCGGGATGCCTCAGG + Intergenic
981426675 4:144611407-144611429 TCTGGTTCTGGGGAGGCCTCAGG - Intergenic
981780236 4:148420902-148420924 TCGGCTTCTGAGGAGGCCTCAGG - Intronic
982271905 4:153599114-153599136 TCAGCTTCTGAGGAAGCCTCAGG + Intronic
982490766 4:156026417-156026439 TCAGCTTCTCAGGAGGTCTCAGG - Intergenic
983010531 4:162540161-162540183 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
983031703 4:162811047-162811069 TTGGCTTCTAAGGAGGCCTCTGG + Intergenic
983629699 4:169837526-169837548 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
983732449 4:171012274-171012296 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
983899594 4:173119570-173119592 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
984074614 4:175159881-175159903 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
985443084 4:189999202-189999224 TCTGCTTCTGGGGAAGCCTCTGG + Intergenic
986124853 5:4875450-4875472 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
986127415 5:4895773-4895795 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
986774024 5:10997168-10997190 TGGGGTTCTCTGAAATCCTCCGG + Intronic
986869523 5:12030366-12030388 TCTGCTTCTGAGAAAGCCTCAGG - Intergenic
986916494 5:12626186-12626208 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
987432883 5:17858010-17858032 TTGGCTTCTAAGGAAGCCTCAGG - Intergenic
987719690 5:21617688-21617710 ACGGCTTCTGGGGAAGCCTCAGG + Intergenic
987856330 5:23424462-23424484 TCAGGCTCTAAGGATGCCTCAGG - Intergenic
987912719 5:24169850-24169872 TCTGCTTCTGGGGAAGCCTCAGG - Intronic
988419221 5:30985390-30985412 TGGGCTTCTGAGGAGGCCTCTGG + Intergenic
988915023 5:35883464-35883486 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
988927965 5:36008283-36008305 TCTGCTTCTGAGGAAGCCTTAGG + Intergenic
989229207 5:39067199-39067221 TCTGCTTCTCGGGAGGCCTCAGG + Intronic
989448080 5:41554428-41554450 TCAGCTTCTAAGGAGGCCTCTGG - Intergenic
989696010 5:44201296-44201318 TCTGGTTCTGAGGAGGCCTTAGG - Intergenic
990617945 5:57526554-57526576 TCTGCTTCTCATGAGGCCTCAGG - Intergenic
991012774 5:61901211-61901233 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
991028596 5:62058458-62058480 TCTGCTTCTAGGGAAGCCTCAGG + Intergenic
991293637 5:65058608-65058630 TTGGCTTCTGAGGAGGCCTCAGG - Intergenic
991460702 5:66855330-66855352 TCAGCTTCTGGGGAAGCCTCAGG - Intronic
992014669 5:72563845-72563867 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
992448666 5:76856120-76856142 TCTGCTTCTCAGAAGGCCTCAGG - Intronic
993226721 5:85175885-85175907 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
993234693 5:85289409-85289431 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
993455874 5:88126348-88126370 TCGGCTTCTGAGGAGGCCACAGG - Intergenic
993848204 5:92972276-92972298 TTGGTTTCTGAAGAAGCCTCGGG + Intergenic
994038387 5:95228876-95228898 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
994187453 5:96831117-96831139 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
994858570 5:105158449-105158471 TCAGCTTCTGAGAAAGCCTCAGG + Intergenic
994927783 5:106140828-106140850 TCAGGTGATCAGGATGCCTCTGG + Intergenic
995040446 5:107581809-107581831 TTGGGTTCTCATGAGGCTTCAGG - Intronic
995181726 5:109236112-109236134 TCGGCTTCTGGGGAAGCCTCAGG - Intergenic
995318298 5:110801379-110801401 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
995414302 5:111891655-111891677 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
995857419 5:116607945-116607967 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
996004807 5:118406860-118406882 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
996258893 5:121441122-121441144 TTGGCTTCTGGGGAAGCCTCAGG - Intergenic
997174729 5:131763487-131763509 TCAGCTTCTGGGGAAGCCTCAGG + Intronic
997592070 5:135080369-135080391 TCGGCTTCTGAGGAGGGCTCAGG + Intronic
997651855 5:135527799-135527821 TCGGTTTCTGGTGAAGCCTCAGG - Intergenic
998745742 5:145258085-145258107 TCTGCTTCTCAGGAGGCTTCAGG - Intergenic
999337601 5:150735583-150735605 TCCAGCTCTCAGGAAGCCACAGG + Intronic
999350415 5:150864922-150864944 TGGGGTTTTCATGAAGCATCAGG - Intronic
1000585368 5:163090954-163090976 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1000938751 5:167335135-167335157 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1001262913 5:170247797-170247819 TCGTCTTCCCAGGAAGCCTTTGG + Exonic
1001666737 5:173439459-173439481 TCGGCTTCTGGGGAAGCCTCAGG + Intergenic
1001767353 5:174261102-174261124 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1001894903 5:175370313-175370335 TCTGCTTCTCGTGAAGCCTCAGG + Intergenic
1002442167 5:179270189-179270211 TCGGGGACTCATGGAGCCTCAGG - Intronic
1003038253 6:2663475-2663497 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1003186786 6:3839140-3839162 TCTGCTTCTGCGGAAGCCTCAGG + Intergenic
1003375386 6:5572205-5572227 TTGGCTTCTCAGGAGGCCTCAGG + Intronic
1003652998 6:7978438-7978460 TCAGCTTCTGGGGAAGCCTCAGG - Intronic
1005113874 6:22315110-22315132 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1005911934 6:30318345-30318367 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1007450586 6:41938543-41938565 TCAGCTTCTAAGGAAGCATCTGG + Intronic
1007655778 6:43450267-43450289 CCTGGTTCTGGGGAAGCCTCAGG - Exonic
1007975122 6:46093965-46093987 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1008032062 6:46707636-46707658 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1008277893 6:49562212-49562234 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1008898292 6:56582485-56582507 TCAGCTTCTGGGGAAGCCTCAGG - Intronic
1009978564 6:70700231-70700253 TTGGCTTCTGCGGAAGCCTCAGG - Intronic
1011127802 6:84025351-84025373 TCTGTTTCTGGGGAAGCCTCAGG - Intergenic
1011554571 6:88561231-88561253 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1013652531 6:112210108-112210130 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1014074099 6:117216885-117216907 TCGGCTTCTGGGGAGGCCTCTGG + Intergenic
1014220230 6:118792312-118792334 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1014266049 6:119278891-119278913 TTGGCTTCTCATGAAGCCTCAGG - Intronic
1014512203 6:122337364-122337386 CCAGCTACTCAGGAAGCCTCAGG + Intergenic
1014660231 6:124161170-124161192 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1014786504 6:125625668-125625690 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1014853093 6:126365376-126365398 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1015979758 6:138826959-138826981 TGGTTTTCTCAGGAGGCCTCAGG - Intronic
1016082747 6:139876045-139876067 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1016877044 6:148876103-148876125 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1016885438 6:148955441-148955463 TCTGGTTATCAGGAAGGCCCAGG - Intronic
1017687793 6:156930387-156930409 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1018377505 6:163227186-163227208 TCTGCTTCCCAGGAGGCCTCGGG + Intronic
1019118304 6:169783511-169783533 TGGGGCTTTCCGGAAGCCTCTGG + Intergenic
1019434002 7:1012440-1012462 CCGGGCGCTCAGGAAGCCTGCGG - Intronic
1019436191 7:1023459-1023481 CCAGGTTCCCAGGAGGCCTCGGG - Intronic
1019644243 7:2120601-2120623 CCTGGCTCTGAGGAAGCCTCTGG - Intronic
1020153048 7:5698315-5698337 TTGGGTTCCCAGGAAGCCTGGGG - Intronic
1020533870 7:9369557-9369579 TCTGCTTCTCAGGAAGCCTCAGG + Intergenic
1020810844 7:12847996-12848018 TCTGCTTCTGAGGAAGCCTCAGG + Intergenic
1020811131 7:12851303-12851325 TCGTCTTCACAGGAAACCTCAGG + Intergenic
1020850801 7:13350379-13350401 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1021382627 7:19985734-19985756 TCTGCTTCTGAGGAGGCCTCGGG - Intergenic
1021425156 7:20491164-20491186 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1021758753 7:23882555-23882577 TCAGCTTCTAAGGAGGCCTCAGG + Intergenic
1022064503 7:26837410-26837432 TTGGCTTCTGAGAAAGCCTCAGG + Intronic
1022981883 7:35611788-35611810 TTGGCTTCTCAGGTGGCCTCAGG - Intergenic
1024845596 7:53637762-53637784 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1024860418 7:53834037-53834059 TAGGCTTCTGAGGATGCCTCAGG - Intergenic
1025255046 7:57379083-57379105 TGGGGTTCCCCGGAGGCCTCCGG - Intergenic
1026058551 7:67006323-67006345 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1026117773 7:67510714-67510736 TCGGCTTCTGGGGAAGCCTCAGG - Intergenic
1026202394 7:68225741-68225763 TCAGGGCCTCAGGAGGCCTCAGG + Intergenic
1026505003 7:70974969-70974991 TTGGGTTCTGGGGAGGCCTCAGG + Intergenic
1026548110 7:71342200-71342222 TTGGCTTCTAAGGAGGCCTCAGG + Intronic
1026738847 7:72965905-72965927 CCGGGTCCCCAGGGAGCCTCAGG + Exonic
1026789856 7:73324535-73324557 CCGGGTCCCCAGGGAGCCTCAGG + Exonic
1027104887 7:75399164-75399186 CCGGGTCCCCAGGGAGCCTCAGG - Exonic
1027483992 7:78736562-78736584 TCAGGTTCTTAGGGACCCTCAGG - Intronic
1027491684 7:78834944-78834966 TCAGCTTCTGAGGAGGCCTCAGG - Intronic
1027498129 7:78913432-78913454 TCAGCTTCTGAGGAGGCCTCAGG - Intronic
1027526702 7:79278277-79278299 TTGGCTTCTGAGGAAGCCTCAGG - Intronic
1029157950 7:98530623-98530645 TCGGTTTCTGGGGAGGCCTCAGG - Intergenic
1029455862 7:100672049-100672071 TGGGGTTCTCAGTAAGAATCCGG + Intergenic
1030088445 7:105837012-105837034 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1030188749 7:106790012-106790034 TTGGCTTCTGTGGAAGCCTCAGG - Intergenic
1030250844 7:107442295-107442317 TCTGCTTCTAGGGAAGCCTCAGG - Intronic
1031078121 7:117232288-117232310 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1031114002 7:117647384-117647406 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1031192426 7:118570920-118570942 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1031618106 7:123904742-123904764 TTGGCTTCTGAGGAAGCTTCAGG + Intergenic
1032543828 7:132725823-132725845 TCTGCTTCTGAGGAGGCCTCAGG + Intronic
1033019431 7:137707696-137707718 TCTGCTTCTGAGGAGGCCTCAGG - Intronic
1033805951 7:144954413-144954435 TCTGCTTCTGAGGAGGCCTCGGG + Intergenic
1034108484 7:148513236-148513258 TCTGCTTCTAGGGAAGCCTCTGG + Intergenic
1034643729 7:152625855-152625877 TCTGCTTCTCCGGAGGCCTCAGG + Intergenic
1034709009 7:153174023-153174045 TCTGTTTCTGAGGAGGCCTCAGG - Intergenic
1035085896 7:156257678-156257700 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1036426303 8:8647976-8647998 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1037415970 8:18649907-18649929 TCAGCTTCTGGGGAAGCCTCAGG - Intronic
1038168420 8:25106781-25106803 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1038364561 8:26918073-26918095 TCTGCTTCTAAGGAGGCCTCTGG + Intergenic
1039535942 8:38312745-38312767 TTGGCTTCTGAGGAGGCCTCAGG - Intronic
1039832130 8:41223778-41223800 TAGGGTCCCCAGGAAGCCCCAGG + Intergenic
1040680336 8:49801302-49801324 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1040791578 8:51236468-51236490 TCTGCTTCTCGGGAAGCCTCAGG - Intergenic
1040911788 8:52527116-52527138 TCAGCTACTGAGGAAGCCTCAGG + Intergenic
1041327687 8:56686704-56686726 TCTGCTTCTGGGGAAGCCTCTGG + Intergenic
1041367537 8:57124527-57124549 TCGTGTCCTCTGGAAGCTTCAGG + Intergenic
1041869529 8:62617111-62617133 TCAGCTTCTGAGGATGCCTCAGG - Intronic
1042072172 8:64948571-64948593 TCTGCTTCTAGGGAAGCCTCAGG + Intergenic
1042383261 8:68143406-68143428 TCAGCTTCTGAGGAGGCCTCAGG - Intronic
1042488855 8:69376656-69376678 TTGGTTTCTGAGGAGGCCTCAGG - Intergenic
1043036087 8:75202186-75202208 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1043383725 8:79728810-79728832 TCTGCTTCTCAGGAGGCCTCAGG - Intergenic
1043765134 8:84121540-84121562 TCAGCTTCTCAGGAGGCCTGAGG + Intergenic
1044028105 8:87198916-87198938 TCAGCTTCTAGGGAAGCCTCAGG + Intronic
1044140399 8:88644458-88644480 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1044881357 8:96726463-96726485 TTGGCTTCTGAGGAGGCCTCAGG + Intronic
1044945539 8:97385573-97385595 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1044976528 8:97670731-97670753 TCTGCTTCTCAGGAGGCCTCTGG + Intronic
1045222470 8:100212873-100212895 CCGAGTCCTCAGGAAGCCGCAGG + Intronic
1045341106 8:101255242-101255264 TCAGCTTCTGAGGAAGCCTTGGG + Intergenic
1045466942 8:102478711-102478733 ACTGGTTCTTAGGAGGCCTCAGG + Intergenic
1046040453 8:108897087-108897109 TCAGCTTCTCAGGAGGCCCCAGG - Intergenic
1046134001 8:110003472-110003494 TGGGCTTCTGAGGAGGCCTCAGG + Intergenic
1046446613 8:114329361-114329383 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1046766563 8:118075713-118075735 TCGGGTTCTCCTGAGGCCTCAGG + Intronic
1046893508 8:119448830-119448852 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1047031841 8:120890449-120890471 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1047077009 8:121415554-121415576 TCTGTTTCTGAGGAGGCCTCAGG + Intergenic
1047574618 8:126139028-126139050 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1048020287 8:130531973-130531995 TCGGCTTCTAGGGAGGCCTCAGG - Intergenic
1048130550 8:131692863-131692885 TCAGTTTCTGATGAAGCCTCAGG + Intergenic
1048473813 8:134725385-134725407 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1048734702 8:137486360-137486382 TCAGCTTCTGAGGAGGCCTCAGG + Intergenic
1048738974 8:137532908-137532930 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1048803875 8:138221204-138221226 TCTGTTTCTGGGGAAGCCTCAGG + Intronic
1048916175 8:139185122-139185144 TCAGCTTCTAGGGAAGCCTCAGG - Intergenic
1049513611 8:143042376-143042398 TAGGGTTGTCAGAGAGCCTCTGG - Intronic
1049517430 8:143068496-143068518 TTGGCTTCTCGGGAGGCCTCAGG - Intergenic
1050907944 9:11028374-11028396 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1051040244 9:12800737-12800759 TCAGCTTCTGAGGAGGCCTCAGG - Intronic
1051297912 9:15616968-15616990 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1052210567 9:25898333-25898355 CCGGCTTCTGAGGAGGCCTCAGG + Intergenic
1052709229 9:32032875-32032897 TCGGCTTCTGGGGAAGCCTCAGG + Intergenic
1052830332 9:33210067-33210089 TTGGCTTCTGAGGAGGCCTCAGG + Intergenic
1054717625 9:68572282-68572304 TCTGCTTCTGCGGAAGCCTCAGG + Intergenic
1054914549 9:70483774-70483796 TCGGCTTCTGGGAAAGCCTCAGG - Intergenic
1055031230 9:71772740-71772762 TCAGCTTCTAAGGAGGCCTCAGG - Intronic
1055561188 9:77523286-77523308 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1055561998 9:77530383-77530405 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1055982228 9:82015474-82015496 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
1056054184 9:82803610-82803632 TCGGCTTCTAGGGAAGCCTCAGG - Intergenic
1056604237 9:88072782-88072804 TCGGCTTCTGAGGAGGCCTTAGG + Intergenic
1056911843 9:90708109-90708131 TCAGCTTCTAAGGAGGCCTCAGG - Intergenic
1057325556 9:94060604-94060626 TCGGCTTCTGGGGAAGCCTCAGG + Intronic
1058189105 9:101891470-101891492 TCTGCTTCTCAGGAGACCTCAGG + Intergenic
1058676118 9:107401711-107401733 TCGGCTTCTTGGGAGGCCTCAGG + Intergenic
1058740123 9:107934544-107934566 TCAGCTTCTAGGGAAGCCTCAGG - Intergenic
1058927631 9:109683156-109683178 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1059261026 9:112976750-112976772 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
1060789600 9:126477086-126477108 TCTGCTTCTCGGGAAGCCCCAGG + Intronic
1061013636 9:127969590-127969612 TCTAGTTCTCTGGCAGCCTCAGG + Intronic
1061941355 9:133885889-133885911 TCTGGTTCTCAGGAACACTCAGG - Intronic
1203489368 Un_GL000224v1:88969-88991 TCTGCTTCTAAGGAAGCCTCAGG + Intergenic
1203501989 Un_KI270741v1:30864-30886 TCTGCTTCTAAGGAAGCCTCAGG + Intergenic
1185498597 X:580133-580155 TGGGCTTCTGAGGAGGCCTCAGG + Intergenic
1185825020 X:3241684-3241706 TCTGCTTCTCAGGAGGCCTCAGG + Intergenic
1186391516 X:9164569-9164591 TCTGCTTCTGGGGAAGCCTCAGG + Intronic
1186475500 X:9854099-9854121 TAGAGTTCTCAGGAAGCCACTGG - Intronic
1186552423 X:10521014-10521036 TCGGCTTCTGATGAGGCCTCAGG + Intronic
1187083332 X:16014949-16014971 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1187950605 X:24466279-24466301 TCGGGTTCCCAGCCTGCCTCAGG + Intronic
1188348080 X:29093249-29093271 TTGGCTTCTGGGGAAGCCTCAGG + Intronic
1188408813 X:29845792-29845814 TCGGCTTCTGGGGAGGCCTCAGG + Intronic
1188661538 X:32765433-32765455 TCGGCTTCTGGGGAGGCCTCAGG - Intronic
1188691919 X:33139715-33139737 TCGGCTTCTGGGAAAGCCTCAGG - Intronic
1189070293 X:37856446-37856468 TTGGTTTCTGGGGAAGCCTCAGG + Intronic
1189661235 X:43302112-43302134 TCTGCTTCTGCGGAAGCCTCAGG - Intergenic
1189758112 X:44292860-44292882 TCTGCTTCTAAGGAGGCCTCAGG - Intronic
1190145669 X:47889717-47889739 CCTGCTTCTGAGGAAGCCTCAGG + Intronic
1190445781 X:50522567-50522589 TCGGCTTTTGAGGAGGCCTCAGG - Intergenic
1190537560 X:51445218-51445240 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1191724082 X:64260389-64260411 TTGGCTTCTGAGGAGGCCTCGGG - Intergenic
1191736946 X:64397068-64397090 TCTGGTTCTGGGGAGGCCTCAGG - Intergenic
1191811473 X:65193922-65193944 TCTGCTTCTGAGGCAGCCTCAGG + Intergenic
1192092716 X:68177606-68177628 TCGGTTTCTGGGGAGGCCTCAGG + Intronic
1192114875 X:68400509-68400531 TCTGCTTCTAAGGAGGCCTCAGG + Intronic
1192295461 X:69842904-69842926 TTGGCTTCTGGGGAAGCCTCAGG - Intronic
1192667535 X:73102970-73102992 TCAGCTTCTGAGGAAGCCTCAGG - Intergenic
1192793416 X:74406489-74406511 TCGGCTTCTGGGGAGGCCTCAGG + Intergenic
1192896186 X:75444951-75444973 TCAGGTTCTCAGGAGGCCTTTGG + Intronic
1192912879 X:75623919-75623941 TTGGCTTCTGAGGAAGCCTCAGG + Intergenic
1192980485 X:76334542-76334564 TCTGCTTCTGAGGAAGCCTCAGG - Intergenic
1193090220 X:77486137-77486159 TCTGCTTCTGAGGAGGCCTCAGG + Intergenic
1193964591 X:87969495-87969517 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1194019588 X:88670295-88670317 TCAGGTTCTGGAGAAGCCTCAGG + Intergenic
1194236061 X:91384230-91384252 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1194306952 X:92259369-92259391 ACTGCTTCTCAGGAAGCCTCAGG + Intronic
1194388422 X:93286712-93286734 TCAGCTTCTAGGGAAGCCTCAGG + Intergenic
1194453364 X:94072343-94072365 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1194461046 X:94168284-94168306 TCAGCTTCTGGGGAAGCCTCAGG - Intergenic
1194559079 X:95397769-95397791 TCAGGTTCTTTGGAGGCCTCAGG - Intergenic
1194846058 X:98811033-98811055 TCAGCTTCTGGGGAAGCCTCGGG + Intergenic
1194864531 X:99049466-99049488 TAGGCTTCTGAGGAGGCCTCAGG + Intergenic
1195035310 X:100966526-100966548 TCGGCTTCTGGGGAGGCCTCAGG - Intergenic
1195140967 X:101959379-101959401 TCGTGTTCTGAGTTAGCCTCTGG + Intergenic
1195846495 X:109234816-109234838 TCTGCTTCTCAGGTAGCCCCAGG + Intergenic
1196966112 X:121057018-121057040 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1197118732 X:122865232-122865254 TCTGCTTCTCGGGAGGCCTCAGG + Intergenic
1197308813 X:124878617-124878639 TTGGCTTCTCATGAGGCCTCAGG - Intronic
1197337147 X:125221882-125221904 TCAGCTTCTGAGGAGGCCTCAGG - Intergenic
1197520478 X:127490874-127490896 TTGGCTTCTGGGGAAGCCTCAGG + Intergenic
1197534288 X:127667549-127667571 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic
1197924675 X:131633986-131634008 CTAGGTTCTCAGTAAGCCTCAGG + Intergenic
1199261318 X:145778813-145778835 TCAGCTTCTGAGGATGCCTCAGG - Intergenic
1199423515 X:147675216-147675238 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
1200032305 X:153306676-153306698 CCGGGTCCTCAGGGAGCCTAGGG - Intergenic
1200050449 X:153426946-153426968 TCTGCTTCTGGGGAAGCCTCAGG - Intergenic
1200103661 X:153700867-153700889 CCGGGCTCTCAGGAAGCAGCAGG + Exonic
1200380375 X:155831030-155831052 TCTGCTTCTGGGGAAGCCTCAGG + Intergenic
1201628200 Y:16038894-16038916 TCAGCTTCTGGGGAAGCCTCAGG + Intergenic
1201728405 Y:17180360-17180382 TCTGCTTCTGAGGAGGCCTCAGG - Intergenic