ID: 1137670303

View in Genome Browser
Species Human (GRCh38)
Location 16:50274630-50274652
Sequence GTGTCATGGAGGCCAAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137670297_1137670303 9 Left 1137670297 16:50274598-50274620 CCTTGGTTTGGGGCTGGGCACTT 0: 1
1: 0
2: 0
3: 12
4: 200
Right 1137670303 16:50274630-50274652 GTGTCATGGAGGCCAAACTGGGG 0: 1
1: 0
2: 0
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137670303 Original CRISPR GTGTCATGGAGGCCAAACTG GGG Intronic