ID: 1137670745

View in Genome Browser
Species Human (GRCh38)
Location 16:50277021-50277043
Sequence AAACTCTTGATTTCACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137670745_1137670749 18 Left 1137670745 16:50277021-50277043 CCACTCTGTGAAATCAAGAGTTT 0: 1
1: 0
2: 0
3: 30
4: 278
Right 1137670749 16:50277062-50277084 GTTCCATCCTTATTTGTTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 153
1137670745_1137670747 -4 Left 1137670745 16:50277021-50277043 CCACTCTGTGAAATCAAGAGTTT 0: 1
1: 0
2: 0
3: 30
4: 278
Right 1137670747 16:50277040-50277062 GTTTTGGTTTTTCTGTGTCCTGG 0: 1
1: 0
2: 3
3: 56
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137670745 Original CRISPR AAACTCTTGATTTCACAGAG TGG (reversed) Intronic
901663076 1:10810983-10811005 AAACTCTTCATTTCATGGAGGGG + Intergenic
901774977 1:11554322-11554344 AAACCCTTCCTTTCCCAGAGGGG + Intergenic
903589753 1:24445744-24445766 AAACACTTGGGTTTACAGAGTGG + Intronic
904262900 1:29300580-29300602 AAACCCTTAATTTTACAGATGGG - Intronic
904487315 1:30835387-30835409 TAACCCTTGATTTTACAGTGTGG + Intergenic
905826636 1:41030569-41030591 CAAATATTGATTCCACAGAGAGG + Intronic
906972297 1:50528368-50528390 ATTCTATTGATTTAACAGAGAGG + Intronic
907046400 1:51302672-51302694 ATTATCTCGATTTCACAGAGGGG - Intronic
907225968 1:52946489-52946511 AGAATCTTGGTTTCACACAGTGG - Intronic
910127341 1:83858311-83858333 AGACTCTTGATTTGCAAGAGAGG - Intergenic
911508161 1:98779677-98779699 AAATTCTTGATTTCTTAGACTGG - Intergenic
916161034 1:161915022-161915044 AAATTCTTTTTTTCAGAGAGAGG - Intronic
917963330 1:180163063-180163085 AAAACCTTGTTTTAACAGAGAGG + Intronic
918715375 1:187779742-187779764 AAACTCATGATTTTAAAGAATGG + Intergenic
919605752 1:199681334-199681356 AAACTTTTGAGTGGACAGAGTGG + Intergenic
923661618 1:235962082-235962104 CAACTCTTGATTCCACAGGGTGG - Intergenic
924693332 1:246374089-246374111 GAACTCTTGATTTCAGGGAGAGG + Intronic
1063327535 10:5119843-5119865 AAACACTTGCATTCGCAGAGTGG - Intronic
1064548785 10:16477612-16477634 AACCCCTTCATTTCACAGATGGG + Intronic
1069313727 10:67071883-67071905 AAACTCTTAATTTCAGATAGAGG + Intronic
1070379059 10:75863325-75863347 ATATTTTTGATTTCAGAGAGTGG - Intronic
1070521564 10:77258102-77258124 AATCTCATTATTTCACAGATTGG - Intronic
1071434142 10:85631259-85631281 AAACTTTTGATGTGACAGAGAGG - Intronic
1071709366 10:88034302-88034324 AAAATGTTGATTTCAAAGAGAGG - Intergenic
1073518298 10:104099459-104099481 AATATTTTGACTTCACAGAGAGG + Intergenic
1073930566 10:108569499-108569521 AAAATCTTAATATGACAGAGAGG - Intergenic
1075914137 10:126152060-126152082 AAAATCTTCATTTCTGAGAGAGG + Intronic
1077270961 11:1680531-1680553 AAACTTTAAAATTCACAGAGGGG + Intergenic
1079487408 11:20949854-20949876 AAGCCCTTGATTTCATAGACGGG - Intronic
1079984025 11:27181101-27181123 GGACTCTTGATTTCAAACAGAGG + Intergenic
1081480264 11:43479862-43479884 GAGCTCTTGCTTCCACAGAGAGG + Intronic
1082306931 11:50590155-50590177 AAACTGCTGATTTCAAAGAAAGG - Intergenic
1082574001 11:54780502-54780524 AAACTGCTGATTTCTGAGAGAGG - Intergenic
1082574010 11:54780674-54780696 AAACTTCTGAATTCAAAGAGAGG - Intergenic
1082580760 11:54865318-54865340 AAACTGCTGATTCCACAGAAAGG + Intergenic
1082581998 11:54882579-54882601 AAACTGTTGATTCCACAAAAAGG - Intergenic
1082583029 11:54897178-54897200 AAACTGCTGAGTTCACAGACAGG - Intergenic
1082585218 11:54929101-54929123 AAACTGTTGAATCCACAGAATGG + Intergenic
1082588569 11:54975261-54975283 AAACTGCTGAATCCACAGAGAGG - Intergenic
1082593833 11:55049465-55049487 AAACTGCTGATTCCACAGAAAGG + Intergenic
1082596005 11:55083147-55083169 AAACTCTTGAATTAAAAGAAAGG + Intergenic
1082841830 11:57696341-57696363 AAAGTCTTGATTTCAGCGAAGGG + Intronic
1083930204 11:65838257-65838279 AAAGACTTGATTCCACAGAAAGG + Intronic
1085733459 11:79018879-79018901 AACTTATTCATTTCACAGAGGGG + Intronic
1087636788 11:100710824-100710846 AAACTCCTGGTTGCACACAGTGG - Intronic
1087818754 11:102688072-102688094 AAACTCTTTATTTCAGTGAATGG + Intergenic
1088035216 11:105303614-105303636 AAACTCATTATTTAACTGAGAGG - Intergenic
1088518092 11:110660287-110660309 AAGCTTTTGTTTTCACAGAGTGG + Intronic
1088885439 11:114002743-114002765 ACACTGTTAATGTCACAGAGAGG - Intergenic
1089305507 11:117523982-117524004 AACTTCTTCATTTCACAGATGGG + Intronic
1091027562 11:132155660-132155682 AAAACCTGGATTTCACAGAGGGG + Intronic
1092944942 12:13444228-13444250 AAACTCATAAAATCACAGAGTGG - Intergenic
1093768029 12:22987316-22987338 AAATTCTTAGTTTCACAGAAAGG - Intergenic
1093934572 12:24987079-24987101 AAACTCTTTTTTTGAGAGAGAGG - Intergenic
1094283814 12:28769930-28769952 AAACTGTTGAGTTAACTGAGTGG + Intergenic
1095330451 12:40955310-40955332 AAACTCTTTACTACACATAGGGG + Intronic
1095362127 12:41355015-41355037 AGACTCTTGATTAAACAGTGTGG - Intronic
1095606740 12:44076892-44076914 AAACTATTGATTTGACAGTTTGG + Intronic
1097602428 12:61710241-61710263 AAAGTCTTGATTTCAAGAAGAGG + Exonic
1097803419 12:63939828-63939850 AATCTCTCCATTTCACAGAAGGG - Intronic
1098982712 12:76974876-76974898 AAACTCTTTCTTTCAGTGAGGGG - Intergenic
1099067184 12:77996518-77996540 AAACTGTTGATTTCTTAGAACGG - Intronic
1099714576 12:86274856-86274878 ACACTCTTCCTTTCACAGAATGG - Intronic
1105650059 13:22367382-22367404 AATCTCCTGATTTCAGTGAGTGG + Intergenic
1106273592 13:28180138-28180160 ATGCTCTTCATTTCACAGATGGG - Intronic
1108787679 13:53925574-53925596 AAATTATTTATTTCGCAGAGAGG - Intergenic
1109332079 13:60942518-60942540 AATTTCTGAATTTCACAGAGAGG + Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1112602895 13:100873911-100873933 AAAATCTTACTTTCAGAGAGTGG - Intergenic
1112703586 13:102039862-102039884 AAACTCTAGAGTTTACACAGAGG - Intronic
1112930009 13:104722643-104722665 AAACACTTGATATCACAAATAGG + Intergenic
1114601089 14:23955937-23955959 ATACACTTTATTTCCCAGAGTGG + Intronic
1114605298 14:23991084-23991106 ACACACTTTATTTCCCAGAGTGG + Intronic
1115407300 14:33031882-33031904 AAGATTTTGATCTCACAGAGCGG + Intronic
1115479580 14:33848407-33848429 ACACTCTCCATTTCACAGATGGG + Intergenic
1116978232 14:51139651-51139673 ACAGTCTTGTTTTCAGAGAGAGG + Intergenic
1117417305 14:55508999-55509021 AAAGTTTTTATTTCTCAGAGTGG + Intergenic
1117665142 14:58048848-58048870 AAACTCTTTATTTCATAAATGGG + Intronic
1118938609 14:70311623-70311645 AAACACTTGATATCACAAAATGG - Intergenic
1119916961 14:78411160-78411182 AAACTCTAGAGTTTACAGACAGG - Intronic
1120166008 14:81200779-81200801 AGACTGTTGATTTCATTGAGTGG - Intronic
1120803248 14:88716849-88716871 AAACTCTTCATGTGAGAGAGTGG - Intronic
1121592992 14:95134240-95134262 AAAATTTTTATTTCACAGAGTGG - Intronic
1122051655 14:99065060-99065082 AAGGTCATGATTTCATAGAGTGG - Intergenic
1123830735 15:24133992-24134014 AAAATCTTGATTTAACATAGGGG + Intergenic
1123835819 15:24191360-24191382 AAAATCTTGATTTAACATAGGGG + Intergenic
1123850984 15:24356757-24356779 AAAATCTTGATTTAACATAGGGG + Intergenic
1123860787 15:24464561-24464583 AAAATCTTGATTTAACATAGGGG + Intergenic
1124828982 15:33129237-33129259 AATTTCTAGATTTCACTGAGTGG - Intronic
1126447497 15:48765124-48765146 AAACTAATGAATTCCCAGAGAGG + Intronic
1126920317 15:53514327-53514349 AAAGCCTTATTTTCACAGAGTGG - Exonic
1127519721 15:59731561-59731583 AAACTCTTCATTTTACAAATGGG + Intergenic
1127579310 15:60322967-60322989 AAGCTTTTCATTTCACAGATGGG - Intergenic
1130692594 15:86096871-86096893 AAACTGGTGATTTCACAAAGAGG - Intergenic
1132371641 15:101303481-101303503 AAGCTTCTGACTTCACAGAGAGG + Intronic
1133518396 16:6532187-6532209 AAACTCTTTATCTTCCAGAGTGG + Intronic
1133521038 16:6557303-6557325 AGAATCTTGCTTTCACAGTGGGG + Intronic
1134260469 16:12647285-12647307 AAACCTTTGATTTGACAGATGGG - Intergenic
1134318641 16:13142720-13142742 CATCTCATTATTTCACAGAGTGG + Intronic
1137670745 16:50277021-50277043 AAACTCTTGATTTCACAGAGTGG - Intronic
1137766327 16:50980388-50980410 CAACTCTTTATTTAACAGAAAGG + Intergenic
1137939483 16:52669602-52669624 AAACTCCTTATTTCACAATGAGG + Intergenic
1138071184 16:53994711-53994733 AAACACTTGAGTTGACAGAAAGG - Intronic
1138960329 16:62021709-62021731 AAACTCTTGAGTTAAGAAAGTGG + Intronic
1139556691 16:67716418-67716440 AAACACTTGTTTTCAGAGAAAGG - Intronic
1141914542 16:87086144-87086166 AAAGTCCTGATTTCCCAGAAGGG + Intronic
1142324337 16:89404662-89404684 AAACTCTGGATGCCACAAAGTGG + Intronic
1203011913 16_KI270728v1_random:301280-301302 AAACTTTTGAATTCAAAGAAAGG - Intergenic
1203030248 16_KI270728v1_random:574439-574461 AAACTTTTGAATTCAAAGAAAGG - Intergenic
1203041473 16_KI270728v1_random:759992-760014 AAACTTTTGAATTCAAAGAAAGG + Intergenic
1143853855 17:9834039-9834061 AAACTCTAGACATTACAGAGCGG - Intronic
1146773376 17:35589360-35589382 AAACCCTTCTTTTCACAAAGTGG - Intronic
1148436107 17:47686867-47686889 AAAGCCTTGATTTGACAGACCGG - Intergenic
1148895011 17:50834480-50834502 AAACTCTGGTTTTCACAGACTGG - Intergenic
1149361956 17:55904465-55904487 AAGCTCCTCATTTCACAAAGGGG - Intergenic
1149801849 17:59576291-59576313 AAACTCTTGATTTGACATTTTGG + Intronic
1149844640 17:59999191-59999213 AAACTCTTGATTTGACATTTTGG - Intergenic
1151353390 17:73544718-73544740 AACCTCTTCATTTCACAGGGAGG + Intronic
1151923788 17:77178402-77178424 AAAGTTTTAATTCCACAGAGAGG - Intronic
1155378584 18:25190424-25190446 AAACTCTTGCTTTCACCGACTGG - Intronic
1155509653 18:26563592-26563614 ATTCTCTTGCTTTCACAGAGAGG - Intronic
1156033951 18:32745461-32745483 TAACTCTCCATTTTACAGAGAGG + Intronic
1156329424 18:36105650-36105672 AAACCCTTGACTTCACAGGCTGG + Intergenic
1156330680 18:36118774-36118796 CCAATCTAGATTTCACAGAGCGG - Intronic
1156766697 18:40665332-40665354 AAACACTTGAGTTTACAGGGTGG - Intergenic
1156867872 18:41908790-41908812 AAACGCTACATTTCACAGTGAGG + Intergenic
1159509518 18:69378376-69378398 AAACATTTGTTTTCAAAGAGTGG - Intergenic
1159541816 18:69787550-69787572 AAACAATTGATTTCACACACTGG - Intronic
1160391180 18:78534537-78534559 ATTCTCTGGGTTTCACAGAGTGG - Intergenic
1162993858 19:14320916-14320938 AAACTCTTGGTTTCCCAGCAGGG - Intergenic
1164710418 19:30353407-30353429 AAAGTGTTGATTTCACACTGTGG + Intronic
1165867629 19:38948676-38948698 CAACTCTTGTTTTCCCACAGAGG - Exonic
1167194424 19:48017719-48017741 TAATTCTTGTTTTTACAGAGCGG - Intronic
1168604332 19:57746626-57746648 AGGCGCTTGATTGCACAGAGTGG - Intronic
1168604651 19:57748829-57748851 CAAATCTTGATTGCACAGAGTGG - Intronic
925012793 2:498244-498266 AACATTTTCATTTCACAGAGCGG - Intergenic
927462789 2:23313381-23313403 AAAATCATTATTTCTCAGAGTGG - Intergenic
928742611 2:34372821-34372843 AAGCTCATGATATGACAGAGAGG + Intergenic
929859302 2:45662498-45662520 TAACTCCTGATTTCACAGCTGGG - Intronic
934084755 2:88500826-88500848 CAACACTTGATTACCCAGAGGGG - Intergenic
935787904 2:106565835-106565857 AAATTCTTGCTTTGAAAGAGAGG - Intergenic
936529577 2:113266537-113266559 GATCTCATCATTTCACAGAGTGG + Intronic
936540447 2:113346026-113346048 AAACTCTTGAGTCCAAATAGTGG + Intergenic
940155652 2:150653533-150653555 AAATTCTTCATTCCAGAGAGAGG + Intergenic
940501379 2:154497958-154497980 ATACACTTCATTTCATAGAGAGG - Intergenic
943821551 2:192329504-192329526 CAAATGTTGAATTCACAGAGTGG - Intergenic
943892035 2:193300325-193300347 AAAGTCTTCATTTCACACAAAGG - Intergenic
944529519 2:200653480-200653502 AATCTCTCTATTTCACAGAAGGG + Intronic
946224149 2:218253711-218253733 AAAATCTGGCTTTCACAGAATGG - Intronic
947041084 2:225920946-225920968 AAAATCTGGATTTCACACAAAGG + Intergenic
947421509 2:229945269-229945291 AAATTCATGATTTAAAAGAGAGG - Intronic
949027619 2:241773852-241773874 CAACTCTTGATCTCCCAGAAGGG - Intergenic
1169372948 20:5042725-5042747 AAACTCTTGATCTGACACTGGGG + Intergenic
1169552491 20:6715324-6715346 AAAACCTTGACTTCAGAGAGAGG + Intergenic
1169671354 20:8106207-8106229 AAACTCCTAATCTCAGAGAGTGG - Intergenic
1170124546 20:12948916-12948938 AAAATCTTGATTTTGCAGAATGG + Intergenic
1170235200 20:14095678-14095700 AAACTCCTGATATCACATATTGG - Intronic
1170434411 20:16310866-16310888 AAACTCCTCTTTTCTCAGAGTGG + Intronic
1171445295 20:25198491-25198513 AAAGTCTTGATTACATAAAGAGG + Intronic
1172543246 20:35738421-35738443 AAACTCTAGACTTAACAGGGTGG - Intronic
1172708724 20:36903176-36903198 AAACTAGTGATTTTACAGGGAGG + Intronic
1173538803 20:43836196-43836218 AGACTCTTGATGTCCCCGAGAGG + Intergenic
1175123008 20:56730983-56731005 AAGCTCTTGATTTCAAAGGTTGG - Intergenic
1177493603 21:21860912-21860934 AAGGTTTTGATTTCACAGAAGGG - Intergenic
1177996729 21:28108926-28108948 AAACTTTTGACTTTGCAGAGTGG + Intergenic
1178367557 21:31999958-31999980 AAACTCATGTTTTCACAGGAGGG + Exonic
1181593393 22:23897844-23897866 AATCCCTTCATTTCACAGATGGG - Intronic
1182077120 22:27502427-27502449 AAACTCTGGGATTCCCAGAGGGG - Intergenic
1183698955 22:39438835-39438857 AGACTCTTGATTTCACTGAAGGG - Intergenic
949296078 3:2524949-2524971 AAACTCTGGATTTTAGAGACAGG - Intronic
949742765 3:7255193-7255215 AACCTCTTTATTTCATAGATGGG - Intronic
949750296 3:7344716-7344738 AAAATGTTGATTTCACTGAAGGG + Intronic
951569933 3:24051168-24051190 AAATTTTTGATTTTGCAGAGGGG + Intergenic
951643002 3:24856776-24856798 GACCTCTTGAACTCACAGAGGGG - Intergenic
951697404 3:25460109-25460131 AAACTAATGATGACACAGAGTGG - Intronic
951995876 3:28728053-28728075 AAATTCTCTATTTCTCAGAGAGG + Intergenic
952433786 3:33251643-33251665 AAACTCATCAATTCATAGAGAGG + Intergenic
952994728 3:38868523-38868545 AAACCTTTGATTTAACAAAGAGG - Intronic
953721681 3:45361515-45361537 AAACTCCTGATTTCAATTAGAGG + Intergenic
954759946 3:52866770-52866792 TTACACTTGATGTCACAGAGTGG + Intronic
954905894 3:54062549-54062571 AAACTATGGATTTTAGAGAGTGG - Intergenic
955091082 3:55751293-55751315 AATCTCTTTATTTCACAAATAGG + Intronic
955740031 3:62080801-62080823 AAAACCTAGATTTCACAGTGAGG - Intronic
956595629 3:70963649-70963671 AAACTCTTGTGTTCCCAGAGTGG - Intronic
958071712 3:88622608-88622630 ATTCTCTGGATTTCAGAGAGGGG + Intergenic
959469505 3:106732281-106732303 AAACTCTTCATTTTACAAAAGGG - Intergenic
960814617 3:121659907-121659929 AAACTCTTTATTTCAAAAATGGG - Intronic
961097196 3:124167467-124167489 AACCCCTTTATTTCACAGATGGG - Intronic
961889929 3:130122258-130122280 ACAATCTTCATTTCACAGATGGG + Intergenic
962197352 3:133375855-133375877 AATCCCCTCATTTCACAGAGTGG - Intronic
963027002 3:140929948-140929970 AAATTTTTGAATACACAGAGTGG + Intergenic
963062863 3:141239223-141239245 CATCTCTTGATTTCCCAGACTGG + Intronic
964756052 3:160091719-160091741 ACTCTGTTGATTTCACAGCGTGG + Intergenic
965467301 3:169045921-169045943 AAGCTTTTGATGTCACAGAAAGG + Intergenic
968183866 3:196617730-196617752 AAACCCTTTGTTTTACAGAGAGG - Intergenic
969961131 4:10945984-10946006 AAATCCTTGGTTTAACAGAGGGG - Intergenic
971828361 4:31657919-31657941 AATATCTTGATTTCAGTGAGCGG - Intergenic
972031786 4:34469296-34469318 AAACTCTGGCCTTCACAGATTGG - Intergenic
972104738 4:35469126-35469148 AAAGTATTGATTTTGCAGAGAGG + Intergenic
972935191 4:44125435-44125457 AAACCTGTGATTTTACAGAGCGG - Intergenic
977622306 4:99151223-99151245 AAAATCTTGTTTTAACATAGGGG - Intronic
979485061 4:121261860-121261882 AACCTCTTTATTTTACAGATGGG + Intergenic
979621351 4:122801804-122801826 AAATACCTGATTTCACAGATGGG + Intergenic
980340166 4:131534198-131534220 AAAATCTTGTTTTAACATAGGGG + Intergenic
981040993 4:140221221-140221243 AAGCTCTTGATGTGGCAGAGAGG - Intergenic
982164425 4:152602202-152602224 ACACTCTTGAGGTCAGAGAGAGG + Intergenic
983623909 4:169786005-169786027 TTACTCTTGATATCGCAGAGGGG + Intergenic
985189492 4:187356477-187356499 AATGTCTTGACTTCACTGAGTGG - Intergenic
987635899 5:20540992-20541014 ACACTCTTGATTTCACATTATGG + Intronic
987946895 5:24621474-24621496 AGAAGCTTGATTTCACTGAGAGG + Intronic
988993864 5:36695899-36695921 AAACTCTTGAATTCAAGGGGTGG - Intergenic
989846210 5:46145768-46145790 AAACTGCTGATTCCACAGAAAGG - Intergenic
989846366 5:46148488-46148510 AAACTCTTGAATCCAAAGAAAGG - Intergenic
990373657 5:55147863-55147885 AAACCCTTCATTTCACAGATGGG + Intronic
990998258 5:61755374-61755396 AGAGTCTTGATTTCCCAGATTGG + Intergenic
991727152 5:69546837-69546859 AACATCTTCATTTTACAGAGGGG - Intronic
991727432 5:69549537-69549559 AAACTGTTGATTTAAAAGACAGG - Intronic
991867524 5:71078340-71078362 AAACTGTTGATTTAAAAGACAGG + Intergenic
991867805 5:71081037-71081059 AACATCTTCATTTTACAGAGGGG + Intergenic
994138393 5:96315344-96315366 AACCTCTGCACTTCACAGAGTGG + Intergenic
994840233 5:104914486-104914508 AATCTCTGTATTTCACAGTGGGG + Intergenic
998646459 5:144067520-144067542 ATACCCTTGATTTCCCAGAGAGG + Intergenic
999268389 5:150281843-150281865 CAACAGTTGATTTCACAGATGGG - Intronic
999525205 5:152397674-152397696 AACCTGCTTATTTCACAGAGGGG + Intronic
1000247779 5:159463147-159463169 AAACTCTTCGTTTCACAAACAGG - Intergenic
1001025331 5:168219395-168219417 ACACACTTGATTGCACAGACAGG + Intronic
1001267957 5:170288754-170288776 AGACTGTGGATGTCACAGAGTGG - Intronic
1003277999 6:4668697-4668719 AACTTCTCCATTTCACAGAGCGG + Intergenic
1009259709 6:61469504-61469526 AAACTGTTGATTTAAAAGAAAGG - Intergenic
1009773765 6:68178416-68178438 AAATTCCTGGTTTCATAGAGAGG - Intergenic
1014504706 6:122240923-122240945 TTACTCTTGACTTCACTGAGAGG + Intergenic
1014641272 6:123913886-123913908 AAACTCTTCATTTAAAAGATGGG - Intronic
1014715486 6:124860380-124860402 AAACTCTTGATATGATAGAGAGG + Intergenic
1014820517 6:125983914-125983936 AATTTCTTGATGTCCCAGAGGGG - Intergenic
1014984385 6:127984582-127984604 AATTTCTTGATTTATCAGAGAGG - Intronic
1015343401 6:132128155-132128177 ACCCTCATGATTTTACAGAGAGG - Intergenic
1015916512 6:138222906-138222928 AAATTATGGATGTCACAGAGTGG - Intronic
1016364005 6:143296372-143296394 AACCTCTTCATTTCCCCGAGGGG + Intronic
1018534825 6:164808960-164808982 AAAGTCTTAGTTTCAGAGAGAGG - Intergenic
1018691413 6:166346997-166347019 GGACTCTTGATGTCACAGAAGGG + Intergenic
1019526642 7:1483394-1483416 AAACTCGGGATTTCACCGTGTGG - Intronic
1019879236 7:3843775-3843797 AAGCTCCTCATTTCACAGATGGG - Intronic
1020013281 7:4817767-4817789 AGACTTATGATTCCACAGAGTGG - Intronic
1020254610 7:6495979-6496001 AACCTCTTGATTGCACAGTGTGG - Intergenic
1022144024 7:27519198-27519220 AATGTCATTATTTCACAGAGAGG + Intergenic
1023127541 7:36970815-36970837 AAACTCCTGATTCTCCAGAGTGG + Intronic
1023210961 7:37804318-37804340 AAAAGCTTGAGTTCACAAAGGGG + Intronic
1024657402 7:51463112-51463134 AAAATATGGATTTCATAGAGAGG - Intergenic
1025529200 7:61855946-61855968 AAACTTTTGAATTCAAAGAAAGG + Intergenic
1025579591 7:62695345-62695367 AAACTGCTGATTTCACTGAAAGG + Intergenic
1025582119 7:62732975-62732997 AAACTGCTGATTCCACAGAAAGG - Intergenic
1025586026 7:62788718-62788740 AAACTGTTGAATCCACAGAAAGG - Intergenic
1025591960 7:62872185-62872207 AAACTGTTGAATGCACAGAAAGG - Intergenic
1025593145 7:62889302-62889324 AAACTGCTGATTCCACAGAAAGG - Intergenic
1025595714 7:62922746-62922768 AAACTACTGAATTCACAGAAAGG - Intergenic
1025596180 7:62929538-62929560 AAAGTGCTGATTTCACAGAAAGG + Intergenic
1025596333 7:62931691-62931713 AAACTGCTGATTCCACAGAAAGG + Intergenic
1027764544 7:82323136-82323158 AACCTCTTTATTTCACATAATGG - Intronic
1028409992 7:90520131-90520153 AAACTGTTGATTTTGCAAAGTGG - Intronic
1031888280 7:127263368-127263390 AAACTCCTGAGTACACAGATTGG + Intergenic
1032516844 7:132512741-132512763 AAACTCTTGCTTTGCCAGATTGG - Intronic
1033298586 7:140164237-140164259 AAACTCTTTGTTGCACAAAGTGG - Intronic
1035474336 7:159131199-159131221 AAAATGCTGATTTCACAAAGTGG + Intronic
1037003080 8:13745084-13745106 GAATTCTTGATTTCTAAGAGTGG - Intergenic
1037513559 8:19607774-19607796 AACCTCTTCATTTTACAGATTGG - Intronic
1037536848 8:19832643-19832665 AAAATCTTACTTTTACAGAGAGG - Intronic
1037947510 8:22998825-22998847 AATCTCTCTATTTTACAGAGGGG + Intronic
1037959797 8:23087986-23088008 AAACTTTTCATTTCAGAGAGTGG - Intronic
1037978345 8:23230891-23230913 AAATTTTTCATTTCAGAGAGTGG + Intergenic
1039644811 8:39269341-39269363 AAACAATTGATTTCACACATTGG - Intronic
1040320660 8:46296508-46296530 ATTCTTTTGATTTCACAGAGTGG - Intergenic
1041580088 8:59448576-59448598 AAACTGTAGAGTTCATAGAGTGG + Intergenic
1044198500 8:89406692-89406714 AAACACTTGATGTCACAAAATGG - Intergenic
1046159214 8:110337881-110337903 AAACTCTTTAATTCATATAGAGG - Intergenic
1046548767 8:115685341-115685363 AATCTCTTCATTTCACAGCTAGG + Intronic
1047198714 8:122745349-122745371 ACAGTGTTGTTTTCACAGAGAGG - Intergenic
1050084415 9:1949761-1949783 AAAATGTTGAATTCAGAGAGTGG - Intergenic
1051563259 9:18467098-18467120 AAACTCTTGTATTCACAGAACGG - Intergenic
1053827993 9:42046154-42046176 AAACTCCTGGTTTCTCAGGGTGG - Intronic
1054363118 9:64198396-64198418 AAACTGTTGATTTAAAAGAAAGG - Intergenic
1054602564 9:67141292-67141314 AAACTCCTGGTTTCTCAGGGTGG + Intergenic
1058001773 9:99873097-99873119 AAACACTTTATTCCACAGAGAGG + Intergenic
1186062307 X:5722641-5722663 CAACTCATGATTTAACAGACAGG + Intergenic
1188425997 X:30047654-30047676 AAGACCTTGACTTCACAGAGAGG - Intergenic
1188544924 X:31294529-31294551 AAACTCTTCATCTTACAGATAGG - Intronic
1190241658 X:48661196-48661218 GAACTCATCATGTCACAGAGAGG - Intergenic
1191265341 X:58384499-58384521 AAACTCCTGATTTAAAAGAAAGG + Intergenic
1191265786 X:58391590-58391612 AAACTGCTGATTTCAAAGAAAGG - Intergenic
1192794398 X:74414190-74414212 AAACTCCTCATTTTACAGATGGG - Intergenic
1192834466 X:74784652-74784674 TAACTCTTTCTTTCACAGATAGG - Intronic
1193820811 X:86162278-86162300 AGCCTCTTGATTTTACAGACAGG + Intronic
1194130683 X:90078088-90078110 AAGCTCTTGATTGCATAGATGGG + Intergenic
1194858916 X:98970321-98970343 TAACTCTTGACTTCACAGTATGG - Intergenic
1194886969 X:99328181-99328203 AAACACTTGATATCACAAAATGG - Intergenic
1195638610 X:107148482-107148504 AAACTCATGTTTTCAAAGAATGG + Intronic
1196354438 X:114773851-114773873 AAAATCTTTATTTTACACAGAGG + Intronic
1197069087 X:122271755-122271777 AAAATCTGGATGTCACACAGGGG - Intergenic
1197831759 X:130650431-130650453 AAACCCCTCATTTCAGAGAGTGG - Intronic
1198020664 X:132654448-132654470 AACCTCATGATGTTACAGAGAGG - Intronic
1198070204 X:133140677-133140699 CAGCTCTTCATTTCACAGACAGG - Intergenic
1198330395 X:135617409-135617431 AACCTCGTGAGCTCACAGAGTGG - Intergenic
1198336532 X:135671590-135671612 AACCTCGTGAGCTCACAGAGTGG + Intergenic
1198573288 X:137981800-137981822 AAACACTTGCTTTAACAGTGAGG - Intergenic
1199940960 X:152627429-152627451 AATCCCTTGAATTTACAGAGTGG - Intergenic
1201144213 Y:11054041-11054063 AAAGTCTGGACTTCACAGCGGGG + Intergenic
1201534810 Y:15034738-15034760 CAACTCTTGATTTAACAGAAAGG - Intergenic
1201610013 Y:15830662-15830684 AAACTTTTTATTTCAGATAGTGG + Intergenic
1202177883 Y:22114365-22114387 AGACTCTTAATGTCCCAGAGTGG - Intergenic
1202213478 Y:22472030-22472052 AGACTCTTAATGTCCCAGAGTGG + Intergenic