ID: 1137673789

View in Genome Browser
Species Human (GRCh38)
Location 16:50293833-50293855
Sequence GGGGCTTTACCTCATTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137673789_1137673807 24 Left 1137673789 16:50293833-50293855 CCCCCAGAATGAGGTAAAGCCCC 0: 1
1: 0
2: 1
3: 3
4: 107
Right 1137673807 16:50293880-50293902 CCGGTTCTGACACCTGTCTTTGG 0: 1
1: 0
2: 0
3: 5
4: 78
1137673789_1137673801 5 Left 1137673789 16:50293833-50293855 CCCCCAGAATGAGGTAAAGCCCC 0: 1
1: 0
2: 1
3: 3
4: 107
Right 1137673801 16:50293861-50293883 CTTGGTGCCCAAGAGTGCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137673789 Original CRISPR GGGGCTTTACCTCATTCTGG GGG (reversed) Intronic
907146278 1:52234753-52234775 GGGGTTTTACATCATCCAGGTGG + Intronic
907508510 1:54940718-54940740 AGGCATTTACCTAATTCTGGAGG - Intergenic
911462099 1:98203873-98203895 GGGGCTAAAGCTCAATCTGGTGG + Intergenic
920554649 1:206895778-206895800 GGGGCTGTGCCTACTTCTGGAGG + Intergenic
924660211 1:246008849-246008871 GAGGATTTACCTCACTCTGCAGG - Intronic
1070448903 10:76537479-76537501 GGGGTTGTACTTCTTTCTGGAGG + Intronic
1070949107 10:80416680-80416702 GTGACTTTACTTTATTCTGGTGG + Intronic
1073450385 10:103605752-103605774 AGGGTTTTAACTCATTGTGGTGG - Intronic
1077216749 11:1398213-1398235 GGGGCTTTCCCTCAGCATGGAGG - Intronic
1077441883 11:2572634-2572656 AGGGCTGAGCCTCATTCTGGGGG + Intronic
1079373484 11:19871742-19871764 GGTTCTTTTCCTCATTCAGGTGG + Intronic
1079436600 11:20459902-20459924 GAGGCTTTACCTGTTTGTGGAGG + Intronic
1084142134 11:67239769-67239791 AAGGCTTTAACTCATTCTGCGGG - Intronic
1088579344 11:111300085-111300107 GGGGCTTTCTCTGATTATGGCGG - Intronic
1089617449 11:119702945-119702967 GGGGGTTTAACCCATACTGGGGG - Intronic
1089744695 11:120608567-120608589 GGGCTTTTTCCTCATTGTGGAGG + Intronic
1089984990 11:122804253-122804275 GGGGCTGTACCTCATTGTTCTGG - Intronic
1090720433 11:129467456-129467478 GTGGCTTTACCACACTGTGGTGG - Intergenic
1091211645 11:133865543-133865565 GGAGCTCTGCCTCCTTCTGGAGG + Intergenic
1097487828 12:60228128-60228150 GGGGCTTTTCCTCCTTTTGCTGG - Intergenic
1100137893 12:91577110-91577132 GGGGCTTTATTTCTTTTTGGTGG - Intergenic
1101445349 12:104733392-104733414 AGGGCCTTGCCTGATTCTGGGGG + Intronic
1104571079 12:129926624-129926646 GGGGCCTTACTTCCTGCTGGGGG + Intergenic
1107177376 13:37414853-37414875 GGGGCATGACCTCATCCAGGTGG - Intergenic
1112940434 13:104854941-104854963 GGGGCTCTACCCCACTGTGGCGG - Intergenic
1113583208 13:111443597-111443619 GGGGCATTAATTTATTCTGGTGG - Intergenic
1121329373 14:93040445-93040467 GGGCCTTGACCTCATTCTGTTGG - Intronic
1121717150 14:96084395-96084417 GTGGCTTTACCTTAGCCTGGAGG + Intronic
1123707437 15:22960160-22960182 TGGGCTTGACCTCAGGCTGGAGG - Intronic
1128632797 15:69282598-69282620 GGGGCTTCACCACTTTCAGGAGG + Intergenic
1131266479 15:90918463-90918485 GGGTCTGGACCTCATCCTGGAGG - Intronic
1136988609 16:35137944-35137966 AGGGCTTCACCTCAGTCTAGAGG - Intergenic
1137673789 16:50293833-50293855 GGGGCTTTACCTCATTCTGGGGG - Intronic
1139380793 16:66529485-66529507 GGGGCTGTACCTCATGCATGTGG - Intronic
1139586568 16:67907784-67907806 GGGGCTCTCCCTCATTCTCCTGG - Intronic
1139692818 16:68651853-68651875 GGAGCTCTGCCTCCTTCTGGGGG + Intronic
1139977366 16:70824353-70824375 GAAGCATTTCCTCATTCTGGAGG - Intronic
1140981097 16:80110151-80110173 GAGATATTACCTCATTCTGGTGG - Intergenic
1141007820 16:80369717-80369739 GTGGCTGTTCCTGATTCTGGTGG - Intergenic
1141849502 16:86635654-86635676 GGGGCCTTAGCTCATAGTGGGGG - Intergenic
1142557770 17:791094-791116 GGGCCTTTATCTCAGTGTGGTGG + Intronic
1142702628 17:1673347-1673369 CAGGCTGTACCTCATTCTGCAGG + Exonic
1152422200 17:80199958-80199980 TGGGCTTCACCTCATTCCAGAGG + Intronic
1154163406 18:11996487-11996509 GTGGCTTTACTTCATGCTTGTGG - Intronic
1157203181 18:45676673-45676695 GGGGCAATTCCTTATTCTGGGGG - Intronic
1160815010 19:1031088-1031110 GGAGCTCTGCCTCCTTCTGGGGG - Exonic
1163601500 19:18251972-18251994 GGGGCTGTACCTCCCCCTGGTGG + Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
925248653 2:2409740-2409762 GGGGCACTGGCTCATTCTGGAGG - Intergenic
925421456 2:3716150-3716172 GGGGATTTAGATCATTGTGGTGG + Intronic
927883435 2:26704658-26704680 GGGACTAGACCTCATCCTGGAGG - Intronic
931051606 2:58421363-58421385 GGGGCTGAACCACATTCAGGAGG - Intergenic
936967997 2:118146236-118146258 TGGGCTTTTCCTCTTTTTGGAGG + Intergenic
944352639 2:198746697-198746719 GGGGCTGGACCACTTTCTGGGGG - Intergenic
947154798 2:227151731-227151753 GGGCACTCACCTCATTCTGGAGG - Intronic
948580157 2:238981600-238981622 AGGGGATTACCTCATACTGGGGG + Intergenic
949061143 2:241958232-241958254 GGGGCTTTTCCTCCTTTTGCTGG - Intergenic
1171214866 20:23345106-23345128 TGGGCGTTTCCACATTCTGGTGG - Intergenic
1174075177 20:47930147-47930169 GGGGCTTTATTTCCATCTGGGGG - Intergenic
1176061525 20:63174866-63174888 GCGGCCTTTCCTCTTTCTGGAGG + Intergenic
1179199571 21:39203958-39203980 GGGGTTTTTCCCCATTTTGGCGG - Intronic
1180019937 21:45116697-45116719 GGGGCTTTTCCCCATTTTGCTGG - Intronic
1182397547 22:30047091-30047113 GGAGCTCTGCCTCCTTCTGGGGG + Intergenic
1183786352 22:40031213-40031235 GTGGCATGAGCTCATTCTGGAGG + Exonic
952206139 3:31182577-31182599 GGAGCTCTGCCTCCTTCTGGGGG + Intergenic
957771546 3:84699126-84699148 GCAGGTTTAGCTCATTCTGGAGG - Intergenic
958985713 3:100777346-100777368 GAAGCTTTACCTCATACTGAGGG - Intronic
959374909 3:105577278-105577300 CTGGCTTTACCTTATTTTGGAGG - Intergenic
959648824 3:108731958-108731980 AGGCATTTACCTCATTCTGCAGG + Intergenic
960943015 3:122946833-122946855 GGGGCATTCCTTCATTCTGTAGG + Intronic
968687381 4:1970457-1970479 GGAGCTTCACCTGATTCTGCTGG - Intronic
968703174 4:2066237-2066259 GTGGCCTTCTCTCATTCTGGTGG + Exonic
970194826 4:13543338-13543360 GGGTCTTTAGTTCATCCTGGAGG - Intronic
971163822 4:24161532-24161554 CGGGATCTACCTCATTCTTGGGG + Intergenic
975219482 4:71797621-71797643 GGGGCATCACCTCAGTCAGGAGG - Intronic
977758398 4:100701058-100701080 AGAACTTTACCTCATTCTAGAGG + Intronic
978105921 4:104901730-104901752 GAGGCTTGCCCACATTCTGGGGG - Intergenic
991201509 5:63999492-63999514 CTGGCTTTACCTCATTGGGGAGG + Intergenic
993884226 5:93397566-93397588 GGGGCTTTCTCATATTCTGGGGG + Intergenic
998901675 5:146862169-146862191 CTGGCTTTACCTCATTCAGAGGG + Intronic
999969071 5:156840651-156840673 AAGACTTAACCTCATTCTGGAGG + Intergenic
1001762619 5:174220859-174220881 GAGGCTTGATTTCATTCTGGGGG - Intronic
1002008760 5:176259272-176259294 GGGGCTTTACCATATTGTCGAGG - Intronic
1003264458 6:4553064-4553086 GGGGCCTTCCCTTATTCTGTGGG - Intergenic
1005306673 6:24520815-24520837 GGGACTGTACCTTATTTTGGGGG - Intronic
1008845908 6:55963925-55963947 GGGGCTTTTGCTCATTCTCTGGG + Intergenic
1013512575 6:110858319-110858341 GGAGCTCTACCTCCTTCTGGGGG - Intronic
1014384912 6:120788099-120788121 AGGGCTGTTGCTCATTCTGGGGG - Intergenic
1022526116 7:31038457-31038479 GGGGCTTTACCTCAGACTAGTGG - Intergenic
1026832433 7:73618440-73618462 GGGTCTTTCCTACATTCTGGGGG + Intronic
1031074481 7:117199536-117199558 GCAACTTTACTTCATTCTGGAGG + Intronic
1032304767 7:130722272-130722294 GGGGATTTTCCTAATTCTAGGGG + Intergenic
1034189841 7:149205501-149205523 GGGGCTTTTCCTGCATCTGGTGG + Intronic
1036836330 8:12071796-12071818 GGGGTTTTATTTAATTCTGGGGG + Intergenic
1036858172 8:12318365-12318387 GGGGTTTTATTTAATTCTGGGGG + Intergenic
1037480879 8:19304013-19304035 GGGGCTTTTACTCATGGTGGAGG + Intergenic
1041737043 8:61122076-61122098 GTGGCTTTAGATCCTTCTGGGGG - Intronic
1044164888 8:88969457-88969479 GTATCTTTACCTCATTCTAGAGG + Intergenic
1045392517 8:101729684-101729706 TGGGCTTTATCTCATGCTGTAGG - Intronic
1048363294 8:133716075-133716097 GGGGCTTTGACTCAGTCAGGTGG + Intergenic
1050816479 9:9819330-9819352 GGGGCTTCATCTCATTCTGGAGG - Intronic
1056836316 9:89958422-89958444 AGGGCTTCACCTGACTCTGGGGG - Intergenic
1060757975 9:126226485-126226507 GGGGCTGCACCTGATGCTGGGGG + Intergenic
1187237767 X:17484464-17484486 GGGGCTATACCACATCATGGGGG + Intronic
1189270344 X:39747133-39747155 GGGGCTTTCTCTGACTCTGGTGG - Intergenic
1191587125 X:62840215-62840237 GGTGCTTTACATCCTTCTAGAGG + Intergenic
1192824220 X:74678317-74678339 GGGCCTTAATCTCATTCTTGAGG + Intergenic
1193423650 X:81315404-81315426 TGGGCTTCACCTTTTTCTGGTGG + Intergenic
1193484358 X:82068311-82068333 GTAGCTTTTGCTCATTCTGGTGG + Intergenic
1194835101 X:98672331-98672353 GGTGCTCTACCTCATTGTGATGG + Intergenic
1200936899 Y:8746223-8746245 GGGCCTTGGTCTCATTCTGGAGG - Intergenic
1200975999 Y:9212724-9212746 GGGGATTGACCTCTTTCTGTGGG + Intergenic