ID: 1137674034

View in Genome Browser
Species Human (GRCh38)
Location 16:50295000-50295022
Sequence CTGGGGCTCTGGAGCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 417}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137674024_1137674034 28 Left 1137674024 16:50294949-50294971 CCCAGAGTGACAGGCCAGTGGGG 0: 1
1: 0
2: 0
3: 28
4: 212
Right 1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG 0: 1
1: 0
2: 5
3: 46
4: 417
1137674027_1137674034 14 Left 1137674027 16:50294963-50294985 CCAGTGGGGAGACTGACAGTGCA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG 0: 1
1: 0
2: 5
3: 46
4: 417
1137674026_1137674034 27 Left 1137674026 16:50294950-50294972 CCAGAGTGACAGGCCAGTGGGGA 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG 0: 1
1: 0
2: 5
3: 46
4: 417
1137674020_1137674034 30 Left 1137674020 16:50294947-50294969 CCCCCAGAGTGACAGGCCAGTGG 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG 0: 1
1: 0
2: 5
3: 46
4: 417
1137674022_1137674034 29 Left 1137674022 16:50294948-50294970 CCCCAGAGTGACAGGCCAGTGGG 0: 1
1: 0
2: 3
3: 20
4: 220
Right 1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG 0: 1
1: 0
2: 5
3: 46
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137674034 Original CRISPR CTGGGGCTCTGGAGCTCAGA TGG Intronic
900242725 1:1624665-1624687 CTGGGGCTGCGGAGCCCAGCAGG + Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
900610099 1:3541073-3541095 CTGGGGCCCTGGACTTCAAAGGG + Intronic
901005619 1:6170359-6170381 CTGGGTCTCTGGGGCTCCCATGG + Intronic
902756045 1:18549995-18550017 CTGGGGTTGGGGAGCTCATAAGG - Intergenic
903131363 1:21281510-21281532 CTTGGTCTCTGGTACTCAGAGGG + Intronic
903377849 1:22877592-22877614 ATACGGCCCTGGAGCTCAGAGGG - Intronic
904457055 1:30654091-30654113 CTGGGGCTTTGGAATTCAGTTGG - Intergenic
906108806 1:43309916-43309938 ATGGGGCTATGGAGCTCAGAGGG + Intronic
906420823 1:45665339-45665361 CATGTGCTCTGGAGCTCAAAGGG + Intronic
906523440 1:46480216-46480238 CTGGGGCTAGGGGGGTCAGAGGG - Intergenic
907355668 1:53871289-53871311 ATGGGGCCCAGGAGCTCAGTGGG + Intronic
909893135 1:81033019-81033041 CTGGGGCTCTTGAGATTACACGG + Intergenic
912241795 1:107918352-107918374 ATGGGACTGTGGAGCTCAGGAGG + Intronic
912739610 1:112181960-112181982 CTGGGTATTTGGACCTCAGAAGG + Intergenic
912966249 1:114239868-114239890 CTGGGACTCTTGAGCTTGGAGGG + Intergenic
913458958 1:119063534-119063556 CTGGGCCTCTGGACCTGTGATGG - Intronic
915447357 1:155981573-155981595 CAGAGACTCTGGAGCCCAGATGG - Intronic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
916733242 1:167584717-167584739 CTGGTCCTGTGGAGCTGAGATGG + Intergenic
918043260 1:180926048-180926070 CTGGAGCTCATTAGCTCAGAGGG - Intronic
918873212 1:190004522-190004544 CTGGGGCTCTGGTCATCTGAAGG + Intergenic
919893794 1:201995572-201995594 CTGGGGTTGGGGAGCTGAGATGG + Intronic
920380970 1:205534364-205534386 CTGGGGGTGTGGAACTCAGCTGG + Intergenic
920563881 1:206958668-206958690 CTGTGTCTCTGCAGCTCAGGAGG - Exonic
922804356 1:228377922-228377944 CAGGAGCTCTGGAGCTGGGAGGG - Exonic
924606733 1:245541868-245541890 CTGGGTTTCTGGGCCTCAGAAGG + Intronic
1063207970 10:3853132-3853154 CTGGGTGGCGGGAGCTCAGAGGG + Intergenic
1064171586 10:13038448-13038470 CTAGGGCTGTGTAGCTCTGATGG + Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065942635 10:30578753-30578775 CTAGGGCTCATGTGCTCAGAAGG + Intergenic
1066062536 10:31736708-31736730 CTGGGCCTCTGGACCTGTGATGG + Intergenic
1067123096 10:43491505-43491527 GAGTGGTTCTGGAGCTCAGAAGG - Intergenic
1067143359 10:43674889-43674911 TTGGGGCTCTGGAGCCAAGGGGG + Intergenic
1067186120 10:44029568-44029590 CTGGGGCTCAGGACCACAGCAGG + Intergenic
1067227478 10:44385264-44385286 CTGCGCCTCGGGAGCACAGAGGG - Intronic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067663278 10:48252373-48252395 CTGGGTCTCTGGAGATTAGTGGG - Intronic
1068385341 10:56318930-56318952 CTGGGTCACTGGAGCTGAGTAGG + Intergenic
1069291451 10:66785629-66785651 CTGGTTCTCTGGCCCTCAGATGG + Intronic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1069547541 10:69339332-69339354 CTGGTCCTCGGGAGATCAGAAGG - Intronic
1069589684 10:69634134-69634156 CTGAGGCTCTGGGCCACAGAGGG + Intergenic
1069599628 10:69695137-69695159 GGGGGGCTCTGCAGCTGAGATGG - Intergenic
1069859594 10:71462098-71462120 CTGTGTCTCTGAAGCTCAGCTGG + Intronic
1070238471 10:74655017-74655039 CTGGGGCCCAGGAGCTCAGCAGG + Intronic
1070558635 10:77549205-77549227 CTGGAGCACTGGAGCTAAAAAGG + Intronic
1070799059 10:79234321-79234343 CTGGGCCTCGGAAGCTCAGGTGG + Intronic
1072852037 10:98906110-98906132 CTGAAGCTCTGGAGCTGGGATGG - Intronic
1073996726 10:109324252-109324274 CTGAAGCTCTGCAGCTCAAATGG + Intergenic
1074776672 10:116772310-116772332 TTGGGGCTCTGGGGCTCTGGGGG - Intergenic
1076057876 10:127390215-127390237 CTGGTGCTCAGCTGCTCAGAGGG - Intronic
1076270689 10:129149806-129149828 CTGGGCCTGAGGAGCTCACAGGG + Intergenic
1076522165 10:131088013-131088035 CTTGGGCTCTGGAGCTTGGAGGG + Intergenic
1076575588 10:131464654-131464676 CTCAGGCTCAGTAGCTCAGAGGG - Intergenic
1076727029 10:132418773-132418795 CCTGGGCACCGGAGCTCAGAGGG - Intergenic
1076787952 10:132760374-132760396 AGGGAGCTCTGGAGCCCAGAAGG - Intronic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1077061792 11:620800-620822 CTGGGGCCCTGGAGCTCTTAAGG - Intronic
1077375418 11:2203234-2203256 CTAGGGCTCTGAAGCTGGGATGG + Intergenic
1077424115 11:2466441-2466463 CTGGGGCTGTGGTTCTTAGAGGG + Intronic
1077600699 11:3572501-3572523 CTGGGGCTCTGATCCTCAGCTGG + Intergenic
1078062773 11:8059180-8059202 CGGGGGCACTGGGGCTCAGGTGG + Intronic
1078581591 11:12543273-12543295 CTGAGCTTCAGGAGCTCAGAAGG - Intergenic
1078895596 11:15594480-15594502 GGGGAGCTCTGGAGCTGAGAGGG + Intergenic
1079203738 11:18396084-18396106 CTGGAGCTATGCAGCTCAGTGGG - Intronic
1080578799 11:33624134-33624156 TGGAGGCTCTGCAGCTCAGATGG + Intronic
1080697175 11:34612675-34612697 CTGGAGCTGTGGTCCTCAGAGGG - Intergenic
1081157736 11:39715974-39715996 CTGGGCCTCTGGACCTGTGATGG - Intergenic
1081437140 11:43039736-43039758 CTGGGGCTGGGGAGTTCTGAAGG - Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1083533497 11:63447269-63447291 GGGGAGCTCTGGAGCTGAGATGG - Intergenic
1084036684 11:66515631-66515653 ATGGGGCCCTGGGGCTCAGATGG - Intronic
1084179049 11:67437532-67437554 CTGGGCCTGTGGAGCTAAGGAGG - Intronic
1085325156 11:75601031-75601053 CTGGGGCTCTGGGCAGCAGAGGG + Intronic
1086931957 11:92703537-92703559 TGGGAGCTCTGGAGCACAGAAGG - Intronic
1087170549 11:95045532-95045554 AGGGAGCTCTGGAGCTCAAATGG - Intergenic
1087172157 11:95060183-95060205 CAGGGACTCTGGAGCTCAAATGG - Intergenic
1087332075 11:96793270-96793292 CTGGGACTCTGGAGCTTGGCAGG - Intergenic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1089647478 11:119889706-119889728 CTGAGGCTCTGGAGCCTGGAAGG - Intergenic
1089754741 11:120678340-120678362 CTGAGGCTGTGGTGCTCAGAAGG + Intronic
1090277545 11:125430410-125430432 CTGGTGCTAAGGAACTCAGATGG - Intronic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1091278850 11:134370584-134370606 CTCCGGCCTTGGAGCTCAGAGGG + Intronic
1091704092 12:2681970-2681992 GTGAGGATCTGGAGCTCAGGAGG + Intronic
1092264516 12:6970559-6970581 CGGCGGCACTGGAGGTCAGAAGG + Exonic
1092485905 12:8901784-8901806 CTGGGCCTCTGGACCTGTGATGG + Intergenic
1093125309 12:15322214-15322236 CTGGGTCTCAGGAGTTCTGAGGG - Intronic
1093470553 12:19496883-19496905 CTTGAGCTCTTGAGCTCAAATGG + Intronic
1093641045 12:21527526-21527548 CAGGGGCCCTGGAGCTCTGGAGG - Intronic
1094395732 12:30003327-30003349 CCTGGGCTCTGGAATTCAGAGGG - Intergenic
1095270752 12:40215757-40215779 CGGGAGCTCTGAAGCTGAGATGG - Intronic
1096480136 12:51934644-51934666 CTTGAGGTCTGGAGCTCAGGAGG - Intergenic
1098557767 12:71838830-71838852 CTTGGGCTCTGCAGCTATGAGGG + Intergenic
1099178683 12:79453128-79453150 CTGGGGCTATGAAACTGAGATGG - Intergenic
1100444300 12:94646910-94646932 CTGGGGCTCTGGACCTACGTGGG - Intronic
1101330871 12:103756967-103756989 CTGGGCCTCAGTAGCCCAGAAGG + Intronic
1101333058 12:103772691-103772713 AAGGGGCTCTGGAGCTGGGATGG + Exonic
1101897704 12:108768725-108768747 CTGGAGCTCTCCAGCTCCGAGGG - Intergenic
1102028875 12:109728648-109728670 GTGGGGCTCTGGAGGTGAGCAGG - Intronic
1102506212 12:113386074-113386096 CTTGGGCTCTGGGGCCCAAAAGG - Intronic
1103703349 12:122859091-122859113 CCCGGGCTCTGGAGCTCATGGGG + Exonic
1103895128 12:124268036-124268058 CTGGGACCCTGGTGCCCAGAGGG - Intronic
1104035491 12:125094515-125094537 CTGTGGCTCTGCAGCAGAGAGGG - Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1107293187 13:38880572-38880594 CTGGGGCTGTTGAGCTCCCAGGG - Exonic
1108396748 13:49997257-49997279 CTGCCGGACTGGAGCTCAGACGG - Intronic
1110079973 13:71297428-71297450 ATGGAGCTCTGGAGCTGTGATGG - Intergenic
1110413041 13:75224116-75224138 ATGGGAATCTGGAGCACAGATGG - Intergenic
1110887671 13:80658786-80658808 CAGGCACTCTGGCGCTCAGAGGG + Intergenic
1111847867 13:93534312-93534334 ATAGAGCTCTGGAGCGCAGAGGG - Intronic
1112289297 13:98130769-98130791 CTGGGACTGTGGTCCTCAGAGGG + Intergenic
1112896599 13:104306842-104306864 CAGAGGCTCAGCAGCTCAGAGGG - Intergenic
1113496940 13:110738558-110738580 CTGGGCCTCTGGACCTGTGATGG - Intergenic
1116223357 14:42115343-42115365 CTGAGGCACTGGAGATCAGGTGG - Intergenic
1118044292 14:61949954-61949976 CTGGGACTCTGAGGCACAGAAGG - Intergenic
1118071345 14:62249680-62249702 TTGAGGCCCTGGAGCTCAGCGGG + Intergenic
1118771694 14:68946667-68946689 CTGGGGCCCTGGTTTTCAGAAGG + Intronic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1121103773 14:91267613-91267635 GTGGGGCCCTGGAACTCAGGAGG + Intergenic
1121554897 14:94829109-94829131 CTGGGGGCCTGGAGCTGGGAGGG - Intergenic
1121611477 14:95283994-95284016 CTGGGCCTCTGGGGCTGTGATGG - Intronic
1122497090 14:102165210-102165232 CAGGAGCTCTGGAGCTGAGGAGG - Intronic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1123053500 14:105559036-105559058 CTGGGGCTCTGGAGCCCCTGGGG + Intergenic
1123078077 14:105679450-105679472 CTGGGGCTCTGGAGCCCCTGGGG + Intergenic
1124257268 15:28154522-28154544 CAGGGGCTCTGGCCTTCAGAAGG + Intronic
1124567071 15:30825979-30826001 CAGGGGCTCTGGCCTTCAGAAGG - Intergenic
1126344007 15:47674116-47674138 CTGGGGCACTTGATCTGAGATGG - Intronic
1126676231 15:51161251-51161273 CTGGGGGTCTGGATCTAGGATGG + Intergenic
1126706081 15:51406354-51406376 CTGGGGCTCTGCAGCCAGGAAGG + Exonic
1127013413 15:54655537-54655559 TTGGGGGTCTGGGGATCAGACGG - Intergenic
1127286604 15:57538790-57538812 CCGGGACTGTGGAGCCCAGAAGG - Intronic
1127519725 15:59731579-59731601 ATGGGGAAATGGAGCTCAGAGGG + Intergenic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1129599258 15:76988760-76988782 GTGGGGGTGTGGCGCTCAGATGG - Intergenic
1129766725 15:78174356-78174378 CTGGGGGGCTCCAGCTCAGAAGG - Intronic
1129977317 15:79833061-79833083 CTGGGGAGCTGGAGCTAGGATGG + Intergenic
1131172711 15:90190078-90190100 CAGGGACTCTGGAGCCCACAAGG - Intronic
1131353589 15:91723904-91723926 CAGGGGGCCTGGAGCTCGGAGGG + Intergenic
1132388135 15:101416602-101416624 CTGGGCCTCTGGGCCTCTGATGG - Intronic
1133364036 16:5196896-5196918 CTGGGACACTGGACCCCAGAAGG + Intergenic
1136050132 16:27644354-27644376 AGGAGGCTCTGGAGCTAAGAGGG - Intronic
1136397524 16:30001274-30001296 CCGGGGCTCCCGAGCACAGAAGG - Intronic
1137273412 16:46917978-46918000 CTGGGGCCCTGGGGATCAGTCGG - Intronic
1137408482 16:48208354-48208376 CTGGGGCACTGGAGCTTGGGAGG + Intronic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137709083 16:50554144-50554166 CTTGGGCTCTAGAGAACAGAAGG - Intronic
1137859789 16:51834911-51834933 CTGGGGCTCTGCATTTCAGAGGG - Intergenic
1137939786 16:52673011-52673033 GGGGAGCTCTGGAGCTGAGATGG - Intergenic
1138515642 16:57534283-57534305 CTGGGGTTCAGGAGCCCTGATGG - Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141423117 16:83930131-83930153 CTGGGCCTTTGCAGATCAGAAGG - Intronic
1141909041 16:87046061-87046083 CACGGGCTCTGGAGCCCAAATGG - Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142194648 16:88733806-88733828 AAGAGGCTCTGGAGCCCAGAGGG + Intronic
1143204538 17:5132818-5132840 CTTGGGCTCTGGAGCCCTGGTGG - Intronic
1143378392 17:6480540-6480562 CCGGGGCTCCGGAGCTGGGAAGG - Intronic
1143730517 17:8880299-8880321 CTGAGGCTCTGGTGCTCAGGGGG - Exonic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144760333 17:17703529-17703551 CTCCGGCTCTGGGGCTCAGGGGG + Intronic
1144829187 17:18122078-18122100 CAGGGGCTCTGGGGCCCTGATGG - Exonic
1144875608 17:18395504-18395526 CTTGGGCTCTGGAGCCCTGGTGG - Intergenic
1145156618 17:20548917-20548939 CTTGGGCTCTGGAGCCCTGGTGG + Intergenic
1145760264 17:27421536-27421558 CTTGGGCTCTGGAGCCCTGGTGG - Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1146160280 17:30555808-30555830 CTTGGGCTCTGGAGCCCTGGTGG - Intergenic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146306188 17:31731391-31731413 CTTGGGCTCTGGAGCCTGGATGG + Intergenic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1146844123 17:36172995-36173017 CTTGGGCTCTGGAGCCCTGGTGG + Intronic
1146856428 17:36260930-36260952 CTTGGGCTCTGGAGCCCTGGTGG + Intronic
1146864189 17:36327445-36327467 CTTGGGCTCTGGAGCCCTGGTGG - Intronic
1146872338 17:36384841-36384863 CTTGGGCTCTGGAGCCCTGGTGG + Intronic
1146879696 17:36435926-36435948 CTTGGGCTCTGGAGCCCTGGTGG + Intronic
1147067049 17:37928033-37928055 CTTGGGCTCTGGAGCCCTGGTGG - Intronic
1147075222 17:37985465-37985487 CTTGGGCTCTGGAGCCCTGGTGG + Intronic
1147078581 17:38007594-38007616 CTTGGGCTCTGGAGCCCTGGTGG - Intronic
1147086747 17:38065011-38065033 CTTGGGCTCTGGAGCCCTGGTGG + Intronic
1147094519 17:38131529-38131551 CTTGGGCTCTGGAGCCCTGGTGG - Intergenic
1147102692 17:38188974-38188996 CTTGGGCTCTGGAGCCCTGGTGG + Intergenic
1147566662 17:41540577-41540599 CGGGGCTGCTGGAGCTCAGATGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149068691 17:52512891-52512913 CTTGTGCTTTGGAGCTCAGGAGG + Intergenic
1149082036 17:52668611-52668633 CTGGGCCTCTGGACCTGTGATGG + Intergenic
1149661811 17:58338116-58338138 CTGGGGCTCTGGGGCCCTGGCGG - Intergenic
1149847265 17:60015441-60015463 CTTGGGCTCTGGAGCCCTGGTGG + Intergenic
1150085623 17:62272058-62272080 CTTGGGCTCTGGAGCCCTGGTGG + Intergenic
1151340549 17:73468060-73468082 CTGGAGCTCTGGGGCTTTGAGGG + Intronic
1151355199 17:73554002-73554024 CTGGGGCCCTGAGGCTCACAGGG + Intronic
1151554347 17:74839094-74839116 ATGAGGCTCTGGGGCTCAGGTGG - Exonic
1151661623 17:75522020-75522042 CTGGGGCTGGGGCGCGCAGAAGG - Exonic
1151908959 17:77068924-77068946 CAGGGGCTCTGGAGCTAATCTGG - Intergenic
1152540079 17:80970396-80970418 CAGGGACTGTGGAGCTCAGGAGG - Intergenic
1152697833 17:81805363-81805385 CCGGGGCAGTGGAGCTCAGGTGG + Intronic
1153873930 18:9348398-9348420 CTGGGGCCCTGGACCTCTTAAGG + Intronic
1153992150 18:10410148-10410170 TTGGGGCCCAGGAGGTCAGAGGG - Intergenic
1155429253 18:25738270-25738292 CTGAGGCTCTGCAGCTCTGCTGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156512613 18:37653830-37653852 CTAGGGATTTGGAGCTCTGATGG + Intergenic
1156546035 18:37964574-37964596 ATGGAGCTCTGGAGCTCAGGAGG - Intergenic
1157600861 18:48892420-48892442 CTGAGGCTCTGGAGCTCCCTGGG + Intergenic
1157681230 18:49608671-49608693 CTTAGGATTTGGAGCTCAGAAGG + Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1159947638 18:74456515-74456537 CCTGGGCTCTGGAGCGCAGGGGG + Intronic
1160017695 18:75157071-75157093 CTGGGGCTCAGGGTCTCAGCGGG + Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162744465 19:12790962-12790984 CTGGGGGTCCCGGGCTCAGAAGG - Intronic
1163738694 19:18997381-18997403 CTGGGCCTCTGGAGCTCCTGGGG + Intronic
1165856203 19:38880546-38880568 CTGGGGCTCTAGAATCCAGAGGG - Intronic
1167623033 19:50569166-50569188 CTGGGGAGCTGGAGCTTTGAGGG + Intergenic
1167659114 19:50785650-50785672 CTGGGGCTCTGTGTTTCAGAAGG - Intergenic
1168106675 19:54169608-54169630 CTATGGCTCTGGAACTAAGACGG - Exonic
1168229246 19:55018475-55018497 GTGGAGCTCTGGGGTTCAGAAGG - Intronic
925046717 2:778008-778030 GTGGGGCCCAGGAGGTCAGAAGG - Intergenic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925924815 2:8662433-8662455 GTGGGGATCTGTTGCTCAGAAGG - Intergenic
926814761 2:16789328-16789350 CTGGGGGTCTGGATCTCACAGGG - Intergenic
926962938 2:18378777-18378799 GGGGAGCTCTGGAGCTGAGATGG + Intergenic
927001629 2:18800972-18800994 CTGGAGCTTTGGGGCCCAGAGGG - Intergenic
927381365 2:22482726-22482748 CAGGGGCTCTGGACCTCAGAGGG + Intergenic
927495497 2:23549098-23549120 CTTGGGCCCTGGAGGTCACAGGG + Intronic
927884985 2:26712849-26712871 CCAGGGCTCAGGAGCTCAGATGG - Intronic
929271414 2:39976564-39976586 CAAGGCCTCTGGAGCACAGAAGG - Intergenic
931264334 2:60646996-60647018 ATAGGGCTCTGGAGGTCAAAAGG - Intergenic
931746143 2:65293551-65293573 CTGCGGCTGTGGAGTTCAGCAGG + Intergenic
932096175 2:68850844-68850866 AAGGGGCTGTGTAGCTCAGAGGG - Intergenic
932306136 2:70705373-70705395 CTGGCTCTCTGGAGCCCAGAAGG + Intronic
932330536 2:70896179-70896201 CTGGGGCTCTGGGTCTGAAATGG + Intergenic
933305086 2:80587570-80587592 CAGGGGCTCTGTAGCTGACATGG - Intronic
933707616 2:85303782-85303804 CTGGTGCTCTGGAGCCTAGCAGG - Intronic
934526954 2:95057911-95057933 CTGGGGCGCTGGAGCAGACACGG + Intergenic
935626014 2:105172787-105172809 CTGGGCCTCTGGACCTGTGATGG + Intergenic
936522562 2:113220308-113220330 CAGGGACAATGGAGCTCAGAAGG + Intronic
936625039 2:114139753-114139775 GTGGGGCTTTGTGGCTCAGAAGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937980868 2:127614608-127614630 ATGGGCTTCTGGAGCTCAGCAGG + Intronic
938312623 2:130302796-130302818 CTGGGGATCTGGAGCACTGCAGG + Intergenic
942191293 2:173473149-173473171 CTGGGGCTAGGCATCTCAGATGG + Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
942865620 2:180670864-180670886 ATGGGACTCTGGAGCTGAGAGGG - Intergenic
946070831 2:217033159-217033181 ATGGGGCCCTGGAGCCCAGAAGG + Intergenic
946609711 2:221444412-221444434 TTGGGGCACTGGGGCACAGAGGG + Intronic
947389120 2:229621739-229621761 TTGGGCCTTTTGAGCTCAGAAGG + Intronic
947731500 2:232433892-232433914 CCAGGGCTCTGGAGCTTACAGGG + Intergenic
948492532 2:238322259-238322281 CTGGGGCTCTGCATTTCAGTGGG - Intronic
949031316 2:241798778-241798800 CTGGGGTTCGGGAGCTGACAGGG - Intronic
1168860556 20:1043426-1043448 CAGGAGCTCTGGAGCAGAGATGG + Intergenic
1169105168 20:2988323-2988345 CTGGGGCTCTGCAGTACACAAGG - Exonic
1169320049 20:4625172-4625194 CTGGGACGCTGGAGCTTAGTGGG - Intergenic
1169564448 20:6838449-6838471 CTGGGGCTCTTGAGCTTTGAGGG - Intergenic
1170977273 20:21176691-21176713 CTAGGGCTCTAGAGCTCTAAAGG + Intronic
1171464548 20:25318464-25318486 CAGGGGGTCTGGACCTCAGGGGG + Intronic
1172093739 20:32450753-32450775 ATGGGGGTCTGGGGCTCAGCAGG - Intronic
1172122409 20:32606240-32606262 GTGTGGCTTTGGAGCTCAGGGGG - Intronic
1172852022 20:37973257-37973279 CATGGGCTCTGGAGATAAGAAGG - Intergenic
1173251747 20:41367182-41367204 CCAGGGCTCTGGAGCCGAGATGG + Intergenic
1173256659 20:41398589-41398611 CTGGGCTTCGGGAACTCAGAAGG - Intergenic
1173328941 20:42058319-42058341 CTGGGTCCCTGGAGCCCAGGTGG + Intergenic
1173595702 20:44257518-44257540 CTGTGGCTCTGGGGCTCTGGGGG - Intronic
1173710484 20:45151342-45151364 CACGGGCTCTTGGGCTCAGAAGG + Intergenic
1173930640 20:46815064-46815086 CATGGTCTCTGGAGCTCAAAGGG + Intergenic
1174306262 20:49616165-49616187 CTGGGCCCCTGGGGCTCTGATGG - Intergenic
1175915053 20:62422426-62422448 CTGGGGCCCTGGAAGTCAGGTGG + Intronic
1175972452 20:62693556-62693578 CTGGGGAACCGGAGCTGAGACGG - Intergenic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1178274272 21:31222451-31222473 CTGCCGCTCTAGAGGTCAGATGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180157327 21:45983912-45983934 CTCAGGCTCAGGTGCTCAGAGGG + Intronic
1181001876 22:19991635-19991657 CTGGGGCTCTGGGGCCCTGAGGG - Intronic
1181732737 22:24859431-24859453 CAGGGACCCTGGAGCTCAGGAGG + Intronic
1181846945 22:25718060-25718082 CTGGGGATCTAAAGATCAGAGGG - Intronic
1182359699 22:29739385-29739407 CTCGGTCTCTGGAGCTCACTCGG + Intronic
1182718173 22:32376647-32376669 CTCCAGCTCTGGACCTCAGAAGG + Intronic
1183063372 22:35348644-35348666 CTGGGGCTCTTGAGCTGCCATGG - Intergenic
1183095133 22:35547413-35547435 CTTGGGCCCTGGAGCTCTGGTGG - Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1183887422 22:40896243-40896265 CTCGAGCTCAGGAGCTCACACGG - Intronic
1184555350 22:45229720-45229742 CTGGGGCTCAGGGGGTCAGCTGG + Intronic
1184768927 22:46586835-46586857 CTGAGGCCCTGCAGCTCTGAGGG + Intronic
1185311577 22:50158656-50158678 CAGTGGCTCTGGAGCTCTGGTGG + Intronic
949192365 3:1265755-1265777 CATGTCCTCTGGAGCTCAGATGG + Intronic
950130742 3:10544689-10544711 CTGGGGCTCTTGAGCACAGGTGG - Intronic
950334000 3:12179315-12179337 CTGGAACTCTGTAGCTAAGAAGG + Intronic
950708402 3:14797976-14797998 CAGGGCCTCTGGAGCACACAGGG - Intergenic
952187220 3:30983026-30983048 CTGGAGATCTAGAGCTGAGAGGG + Intergenic
952500281 3:33955470-33955492 GGGGGGCTCTGGAGCTCTCATGG - Intergenic
952893487 3:38060535-38060557 CTGGGGCTTGGGAGCTGAGAAGG + Intronic
953071981 3:39529906-39529928 CTGGGGCTTAGGAGCTAAAATGG + Intergenic
953245543 3:41188140-41188162 ATGGAGACCTGGAGCTCAGATGG + Intergenic
955718520 3:61856862-61856884 TTGGGGCACTGAACCTCAGAGGG + Intronic
956909988 3:73807443-73807465 CTGGGCCTCTGGACCTGTGATGG - Intergenic
958822589 3:98992665-98992687 CAGGGGTTCAGGAGGTCAGAAGG - Intergenic
959893706 3:111583825-111583847 CTGGGCCTCTGGACCTGTGATGG + Intronic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
961415774 3:126755442-126755464 CTGAGGCTCTGCAGCACAGCAGG + Intronic
961603633 3:128078046-128078068 CAGGGGTTCTGGGGCTCAGCAGG - Intronic
961666164 3:128494111-128494133 CTGGGGACCTTGAGCCCAGAGGG + Intergenic
962045728 3:131757722-131757744 CTGGGCCTCTGGGCCTGAGATGG - Intronic
962446721 3:135472508-135472530 TCTGGGCTCTGCAGCTCAGAGGG + Intergenic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
966123434 3:176548230-176548252 CTGGGCCTCTGGACCTTTGATGG + Intergenic
966747441 3:183290932-183290954 AGGGGCCTCTGGAGATCAGATGG - Intronic
967130456 3:186465614-186465636 AGGGTGCTCTGGAGCTGAGATGG - Intergenic
967937323 3:194739404-194739426 CTTGCGATCTGGAGCGCAGATGG + Intergenic
968138108 3:196233763-196233785 CAGGGGCCCTGGAGAACAGATGG + Intronic
968313512 3:197703493-197703515 CTGGGTCCCTGGAGCTCAGCAGG - Intronic
968588938 4:1448266-1448288 GTGGGGCTCTGGATCTGAGTGGG + Intergenic
968751670 4:2393121-2393143 CTGGGGCTCTGCAGATGAGATGG - Intronic
969015122 4:4098807-4098829 CTGGGGCTCTGATCCTCAGCTGG + Intergenic
969249774 4:5959463-5959485 GCTGGGCTCAGGAGCTCAGAGGG + Exonic
969563422 4:7963603-7963625 CTGGGGCTCTGAGATTCAGATGG + Intergenic
970867284 4:20773514-20773536 AGGGCTCTCTGGAGCTCAGACGG + Intronic
972333571 4:38085509-38085531 CTGGGGGACTGGAACCCAGAAGG + Intronic
972870690 4:43293883-43293905 CTGGAGTTCTGGAGCTGAAATGG + Intergenic
973890938 4:55366708-55366730 CTGAGGCTCTGGAGCCAAGGGGG - Intronic
974085455 4:57255796-57255818 ATAGTGCTCTGGAGCTGAGATGG - Intergenic
974175203 4:58313775-58313797 CTGGGGCGCTGGATCTCTGGAGG - Intergenic
976506889 4:85857888-85857910 CTGGCCCTCTGAAGCTCTGAAGG + Intronic
978612665 4:110560925-110560947 GTAGGGCTTTGGAGGTCAGAGGG + Intronic
979390160 4:120118213-120118235 CTGGGCCTCTGGACCTGTGATGG + Intergenic
980727806 4:136787708-136787730 CTGGGCCTCTGGGCCTGAGATGG - Intergenic
981830988 4:149001666-149001688 CTGGAGTTCTGGAGTTCAGGGGG - Intergenic
982087795 4:151853925-151853947 CCGGGGTTCTGGAGCTCGGTGGG + Intergenic
982790605 4:159587015-159587037 CTGGGCCTCTGGGTCTGAGATGG + Intergenic
984017367 4:174441983-174442005 CTGGGCCTCTGGGCCTGAGATGG + Intergenic
985631305 5:1015483-1015505 CTGGGTCCCTGGAGCTCTGAAGG + Intronic
985731351 5:1550781-1550803 CTGGGGCTGAGGAGCACAGCTGG + Intergenic
986022401 5:3816841-3816863 TTGGGGCTGTTGGGCTCAGACGG + Intergenic
986339324 5:6775866-6775888 CTGGGGCTCAGGTGCTCACGAGG + Intergenic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
988060961 5:26170268-26170290 CTTGGGCCCTTGAACTCAGATGG - Intergenic
988519871 5:31936088-31936110 GTGGGGCTCTGGAGCTCAGGAGG + Intronic
990003684 5:50922365-50922387 CTGGGGCTCTGGGGCTGGGTCGG + Intergenic
990488310 5:56280285-56280307 CTACTGCTCTGGAGCACAGAAGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991925870 5:71704429-71704451 CAGGGACTCTGGACCACAGATGG + Intergenic
992024219 5:72654564-72654586 CTGGGCCTCTGGAGCAGAGCTGG + Intergenic
992169922 5:74091526-74091548 CTGGTGTTCTGTAGCACAGATGG - Intergenic
992365338 5:76084257-76084279 CCGAGGCTGTGAAGCTCAGAGGG + Intronic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
992416783 5:76559535-76559557 GTGGGCCTCTGGGGCTCACAGGG - Intronic
993898869 5:93571087-93571109 CTGGGGCCCTGCAGCACCGAGGG + Intergenic
993962148 5:94311961-94311983 CAGGAGCTCTGGAGCTCTGGTGG - Intronic
994084880 5:95747242-95747264 AGGGGGCTCTGGAGCTTAGATGG - Intronic
995410960 5:111856553-111856575 CATGGGCTCTGGAATTCAGATGG - Intronic
996019698 5:118577745-118577767 CTGGGGCCCAGGAGCTGTGAGGG - Intergenic
996030524 5:118699627-118699649 GTGGGGCTCTGGAGCTGGAATGG - Intergenic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
996857077 5:128020333-128020355 TTGTGGCTCTGTTGCTCAGAAGG - Intergenic
997304779 5:132829397-132829419 ATGTGGCTCTGGAGTTCAGCAGG + Intronic
997859731 5:137405612-137405634 GGGGCGATCTGGAGCTCAGATGG - Intronic
997975298 5:138438501-138438523 CTGTGACTCAGGAGCTCAGGTGG + Intergenic
998061044 5:139119000-139119022 CAGAGGCCCTGTAGCTCAGAGGG - Intronic
998367604 5:141640984-141641006 CTGGGCCTCTTGTGCTAAGAGGG - Exonic
998959565 5:147470355-147470377 CCGGTGCTCTGTAGCTCAGCTGG + Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999250289 5:150178455-150178477 CTGGGACGCTGGAGCTAAGGGGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1002355620 5:178626833-178626855 CTGGGCTTCTGGAGCTGAGTTGG - Intronic
1002368503 5:178730846-178730868 CTGGGGCCCTCCAGCTCACAGGG - Intergenic
1003026959 6:2563688-2563710 CTGTGGATCTGGAGCTCCCATGG - Intergenic
1003207039 6:4021795-4021817 CTGCGGCCAGGGAGCTCAGATGG - Intronic
1003564189 6:7208556-7208578 CTGGGGCTCCGGGGCTCAGTGGG + Intronic
1004179647 6:13370127-13370149 CTGGGGCTCAGGAACTGGGATGG - Intronic
1006144142 6:31948160-31948182 CTGGGGCCCTGTTGTTCAGAGGG - Intronic
1006577430 6:35056778-35056800 CTGGGGCTCTGCAGCCCGGGTGG - Intronic
1006915223 6:37589618-37589640 GTGGGCCTCTGAAGCTCAGGTGG + Intergenic
1007683225 6:43648800-43648822 CTGGGGCTCTGGAAGGCAGGTGG + Intronic
1008844720 6:55949624-55949646 CTGGTGCTTTGGAGCTCTGAGGG - Intergenic
1009960538 6:70515590-70515612 CAGGGGCTCTGGGGGACAGAGGG + Intronic
1011221168 6:85055952-85055974 ATGGGGCTCTGGAGCAGAAAAGG + Intergenic
1014198534 6:118584490-118584512 CTGGGAATCTGAAGCTCAAAAGG + Intronic
1014881428 6:126728495-126728517 ATGGGTCTCTGCAGGTCAGATGG - Intergenic
1015664674 6:135615531-135615553 GGGGAGCTCTGGAGCTCAGAAGG + Intergenic
1017615682 6:156244140-156244162 CTGGTCCTCTGGAGCCCAGGAGG - Intergenic
1017746550 6:157451968-157451990 CTGGGGCTGTGGGGCCCAAAGGG + Intronic
1018866948 6:167753558-167753580 CTGGGCCTCTGGACCTGTGATGG + Intergenic
1019007901 6:168817962-168817984 CTGGGTTTCTGGACCTGAGATGG + Intergenic
1019183891 6:170209730-170209752 CCGGAGCTCTGGAGCTCTGCAGG - Intergenic
1019351683 7:557010-557032 CTGGTTCTCTGCAGCTCAGGAGG - Intronic
1020257394 7:6509703-6509725 CAGTTGCTCTGCAGCTCAGAAGG - Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021848834 7:24788233-24788255 CTGGGGCTCTGGGGCTCTCTCGG + Intergenic
1022549664 7:31227147-31227169 CTGGGCCTCTGGGCCTCTGATGG - Intergenic
1022861961 7:34376842-34376864 CTAGGTCTCTGGAGCTGTGATGG - Intergenic
1024579045 7:50787252-50787274 ATGGGGCTCTGGAGAGCAGGAGG + Intronic
1026833736 7:73624666-73624688 CCGGTGCTCTGGAGCTCTGGCGG + Intergenic
1027460539 7:78447536-78447558 ATGGGGATCTGGAGGTCAGCGGG + Intronic
1027461004 7:78453620-78453642 ATGGGGATCTGGAGGTCAGCGGG - Intronic
1028080318 7:86567478-86567500 CTGGGACTCTGGAGCTTGGTGGG + Intergenic
1030267376 7:107634295-107634317 CTGAGGCACTTGAGCCCAGAAGG + Intergenic
1031175004 7:118338942-118338964 CTGGGCCTCTGGACTTCTGATGG - Intergenic
1031791942 7:126117959-126117981 CTGGGCCTCTGGGCCTCTGATGG - Intergenic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034338473 7:150338184-150338206 CTCTGGCTCTGGAGCACAGGAGG + Intergenic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1036243908 8:7100830-7100852 CTGGGGCTCTGATCCTCAGCTGG - Intergenic
1036608328 8:10328107-10328129 ATGGGGATCTGGAGTCCAGAGGG - Intronic
1037765524 8:21770104-21770126 GTGGGTCCCTGAAGCTCAGAGGG - Intronic
1038207606 8:25482090-25482112 CAGGGCCCCTGGAGCTCAGCAGG - Intronic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1039503002 8:38031459-38031481 CTGGGGCTCCGGGGCTGGGAGGG - Intronic
1040912810 8:52538175-52538197 CTGGGGCTCTGCAGCACTGTAGG + Intronic
1042307696 8:67348518-67348540 CTGGGGCTCTGCAAATTAGATGG + Intergenic
1044802032 8:95966955-95966977 TGGTGGCTCTGGAGCTTAGAGGG - Intergenic
1045013254 8:97977009-97977031 GTGGATCTCTTGAGCTCAGAAGG + Intronic
1047153818 8:122294816-122294838 CTAGGTCTCTGGACCTCTGATGG + Intergenic
1047213498 8:122858566-122858588 GTGTGCCTGTGGAGCTCAGAGGG + Intronic
1048929156 8:139297190-139297212 CTGCAGCTCTGCAGCTCAGAGGG + Intergenic
1048943855 8:139426675-139426697 CTGGGGTCCTGGAGCCCACAGGG + Intergenic
1049049489 8:140183301-140183323 CTGGGGTTGTAGAGCTCAGAAGG - Intronic
1049789141 8:144465175-144465197 CTGGGGCCCTGGAGCCCAAGTGG + Intronic
1051245868 9:15110381-15110403 GAGGAGCTCTGGAGCTGAGAAGG + Intergenic
1051939144 9:22483844-22483866 CTGGGGATCTGGAGCTGAAGCGG - Intergenic
1052336387 9:27324462-27324484 CTGGGGCACTGGAGCTTGGTGGG - Intergenic
1055095316 9:72407427-72407449 GTGGTGCTCTGAAGCTTAGAAGG - Intergenic
1056809026 9:89750114-89750136 ATGGGACTCTGGTGCTCAGATGG - Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG + Intronic
1059710735 9:116865534-116865556 AGGGAGCTCTGGAGCTGAGAAGG + Intronic
1060004988 9:119991975-119991997 CCGGGGGTCTGGGGCTGAGAGGG + Intergenic
1060147820 9:121267834-121267856 CTGGGGCCAAAGAGCTCAGATGG - Intronic
1060243382 9:121924322-121924344 CTGGGGATGTGGCACTCAGATGG - Intronic
1060275590 9:122179895-122179917 CTGGGCCTCTGGGCCTCAGATGG + Intronic
1060283000 9:122226581-122226603 CAGAGGCGCTGAAGCTCAGAAGG + Intronic
1060447968 9:123709275-123709297 CTGGGGCACTGGTGCTCAGAGGG - Intronic
1060553055 9:124494770-124494792 CTGGGGGCCAGGGGCTCAGAAGG + Intronic
1060936083 9:127517079-127517101 CTGGGGCCCTGGAGCGGGGACGG - Intronic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061417975 9:130458332-130458354 CTGGGGCTCTGTATGCCAGATGG + Intronic
1062353073 9:136148597-136148619 CTGGGCATGCGGAGCTCAGATGG + Intergenic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1188221824 X:27549947-27549969 GGGGAGCTCTGGAGCTGAGATGG - Intergenic
1189225651 X:39411192-39411214 TGGGGGCTTTGGAGCTGAGATGG + Intergenic
1189297059 X:39926316-39926338 CTGGGGCTCAGGCTCTCAGGGGG + Intergenic
1189384191 X:40523913-40523935 AGGGAGCTCTGGAGCTGAGATGG + Intergenic
1189682283 X:43529161-43529183 GAGGAGCTCTGGAGCTCGGATGG - Intergenic
1189862812 X:45290801-45290823 CTGGGGCTCTGGAGTTTTGATGG + Intergenic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1190691306 X:52915671-52915693 TGGGGGCTCTGGGGCTCAGCTGG + Intergenic
1190694677 X:52940121-52940143 TGGGGGCTCTGGGGCTCAGCTGG - Intronic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1191671269 X:63750988-63751010 GGTGGGCTCTGGAGCTCAGTGGG + Intronic
1191793777 X:64999731-64999753 CTGGGGCTCTCGAGCTTGGTAGG + Intronic
1192928885 X:75784274-75784296 GTGGGGCTCTAGAGCCCACAGGG - Exonic
1193363989 X:80608629-80608651 CAGGGGGTCAGGAGCTCACAGGG - Intergenic
1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG + Intergenic
1195177904 X:102328596-102328618 CTGGGGCTGTGGAATTCATAAGG + Intergenic
1195180960 X:102358497-102358519 CTGGGGCTGTGGAATTCATAAGG - Intergenic
1197191097 X:123648604-123648626 CTGGGACGCTGGAGCTCAGCGGG + Intronic
1197720026 X:129738846-129738868 CTGGGGCTCTGCCGCTGAGAGGG + Intergenic
1198713789 X:139534463-139534485 CTGTGGCTGTGGAACTCACAAGG - Intronic
1199325449 X:146493436-146493458 CTGGGCCTCTGGACCTGTGATGG - Intergenic
1199601565 X:149544264-149544286 CAGGAGATCTGGAGCTCAGAAGG + Intronic
1199648812 X:149935220-149935242 CAGGAGATCTGGAGCTCAGAAGG - Intronic
1200046953 X:153408301-153408323 CTGAGGCCCTGAAGCTCAGCTGG - Intergenic
1200155829 X:153974480-153974502 CTGGGCCTGAGGAGCTCACAGGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic