ID: 1137674584

View in Genome Browser
Species Human (GRCh38)
Location 16:50298014-50298036
Sequence GATGAACCTCAGAGGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137674574_1137674584 27 Left 1137674574 16:50297964-50297986 CCACCCTTGCTGAGGGCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG 0: 1
1: 0
2: 0
3: 19
4: 191
1137674578_1137674584 23 Left 1137674578 16:50297968-50297990 CCTTGCTGAGGGCTTAAGGAGGG 0: 1
1: 0
2: 3
3: 15
4: 186
Right 1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG 0: 1
1: 0
2: 0
3: 19
4: 191
1137674576_1137674584 24 Left 1137674576 16:50297967-50297989 CCCTTGCTGAGGGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG 0: 1
1: 0
2: 0
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137674584 Original CRISPR GATGAACCTCAGAGGGCTCT CGG Intronic
900700700 1:4047129-4047151 GATGAACCTGACGGGGCTGTGGG - Intergenic
902838729 1:19062229-19062251 GCTGAATCTCAGAGGGGTCGAGG - Intergenic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
903660174 1:24972299-24972321 GAGAGAGCTCAGAGGGCTCTGGG - Intergenic
905715569 1:40146558-40146580 GGTAAAACCCAGAGGGCTCTAGG - Intergenic
905792196 1:40795940-40795962 GACCTACCTCATAGGGCTCTTGG - Intronic
906273014 1:44496293-44496315 GATGGAAATCAGAGGGATCTGGG + Intronic
907872493 1:58455559-58455581 AATGAACTTCAGAGGTCTTTGGG + Intronic
908554549 1:65244804-65244826 GAAGAACTTAGGAGGGCTCTAGG + Intergenic
909564026 1:77034964-77034986 GTGGAACCTCAGGGGGCTATGGG - Intronic
912384276 1:109263556-109263578 GTGGAGCCTCAGAGGGCCCTGGG - Intronic
912406521 1:109443196-109443218 CATGAAACTCAGAGGGCACAGGG + Intergenic
912550441 1:110482011-110482033 GTTGAAACTCAGAGGGCTTTGGG + Intergenic
918312254 1:183293199-183293221 GATGCACCTTGGTGGGCTCTGGG - Intronic
924874873 1:248091572-248091594 GTTGAAAATCAGATGGCTCTCGG + Intronic
1067228948 10:44393602-44393624 GATGAGCCTCCCAGAGCTCTAGG - Intergenic
1075086823 10:119419231-119419253 CCAGAAGCTCAGAGGGCTCTGGG - Intronic
1076225110 10:128768305-128768327 GAAGTACCCCAGAGGACTCTGGG + Intergenic
1076296286 10:129387405-129387427 GCTGAACTTCCCAGGGCTCTGGG - Intergenic
1076542599 10:131223732-131223754 GATGGACCCCAGAGGCTTCTGGG - Intronic
1076920831 10:133453972-133453994 GCTGAAGCCCAGAGGGCTGTGGG + Intergenic
1078054237 11:7994278-7994300 AATGAACCCCAGAGGTCTCATGG - Intronic
1078171432 11:8931938-8931960 GATCAACCCTGGAGGGCTCTGGG + Intronic
1083220578 11:61249621-61249643 GATGAACCCCTGAGGGCTCAGGG + Intronic
1083304026 11:61753560-61753582 GAGGAGCCTCAGAGGGCTGGTGG - Intronic
1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG + Intronic
1085652469 11:78280794-78280816 GATGATCCGCAGAGGCTTCTTGG + Exonic
1091982475 12:4877523-4877545 GAATAATTTCAGAGGGCTCTGGG - Intergenic
1092068125 12:5609369-5609391 GGACAACCTCAGAGGGCACTTGG - Intronic
1092161344 12:6317063-6317085 GAGGGAGCTCAGAGAGCTCTGGG + Intronic
1094551101 12:31452368-31452390 CAAGAACCTCAGAGAGTTCTTGG + Exonic
1094759766 12:33517806-33517828 TACCCACCTCAGAGGGCTCTTGG - Intergenic
1096499160 12:52054936-52054958 GAACAACTTCAGGGGGCTCTGGG - Exonic
1096660298 12:53119955-53119977 GATGAATCTCAAAGGGCCATTGG - Intronic
1099902560 12:88729703-88729725 GATGAAGCTCTGGGGGTTCTGGG - Intergenic
1101252604 12:102950737-102950759 CAGGAACCTCTGAGAGCTCTTGG - Intronic
1101686725 12:107031234-107031256 GATGAAGCTCAGAGTTCTCAGGG - Intronic
1102570116 12:113822397-113822419 GATGCATTTCACAGGGCTCTGGG + Intronic
1102695544 12:114796512-114796534 GACCAACATCACAGGGCTCTTGG - Intergenic
1105706738 13:22971876-22971898 GCTGGACTTCAGAGGGCTCTTGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107967101 13:45607043-45607065 AAACAACCCCAGAGGGCTCTGGG + Intronic
1111456096 13:88486356-88486378 GAGGAAACTGAGAGGGCTATAGG + Intergenic
1112041458 13:95552550-95552572 GAGGGGCCTCAGAGGGCTCGCGG - Intronic
1113937484 13:114002029-114002051 GCCGAGCCTCAGAGGGCCCTGGG - Intronic
1116457637 14:45137200-45137222 GATGAAGCTCATAAAGCTCTCGG + Exonic
1116737638 14:48713371-48713393 GATGAACCACAAAGGCCTCTAGG + Intergenic
1119019668 14:71098076-71098098 GTTGAAGCTCAGATGGCTGTAGG + Intronic
1119641106 14:76315550-76315572 GATCAACCTCATAGGGTTGTTGG + Intronic
1120210565 14:81629695-81629717 GACCAACCTCAGAGGTCTCAGGG - Intergenic
1120594173 14:86413668-86413690 ATTGAAACTCAGAGGGCTCATGG - Intergenic
1121638949 14:95472638-95472660 GCTGAAGCTCAGAGAGCTCTGGG + Intronic
1122273173 14:100577520-100577542 GATCCACTGCAGAGGGCTCTGGG + Intronic
1122850094 14:104523349-104523371 GCTGGGCCTCAGAGGGCTCTGGG - Intronic
1122965314 14:105121208-105121230 GTTGAACCACAGAGTGATCTTGG - Intergenic
1123923379 15:25086479-25086501 GAGGAAAATCAGAGCGCTCTGGG - Intergenic
1123923716 15:25088756-25088778 GAGGAAACTCAGAGTGCTCTGGG - Intergenic
1124087342 15:26563267-26563289 AATGAACCCCAGAGGGACCTGGG + Intronic
1128226649 15:66006368-66006390 CATCCCCCTCAGAGGGCTCTAGG - Intronic
1128384885 15:67140522-67140544 AATGACCTTCTGAGGGCTCTGGG + Intronic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1128596063 15:68950791-68950813 GATGAAACACAGAGGGTTTTAGG - Intronic
1129956280 15:79639738-79639760 AATAAAGCTCAGAGGGCCCTGGG + Intergenic
1134103943 16:11471851-11471873 GTGGAGACTCAGAGGGCTCTGGG + Intronic
1134195401 16:12155728-12155750 GATGAACTGCAGAAGGTTCTGGG - Intronic
1136499916 16:30664943-30664965 GATGAGGCTCGGAGGCCTCTGGG + Intronic
1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG + Intronic
1138487711 16:57357536-57357558 CCTGATCCTCAGAGGGCCCTGGG + Intergenic
1138656837 16:58496268-58496290 GCTGCAGCTCAGAGGGCTCAGGG - Intronic
1140671729 16:77286195-77286217 GGTGAACCACATATGGCTCTAGG - Intronic
1141108232 16:81250978-81251000 GTCAAACCTCAGAGGGCTCGGGG - Intronic
1141940664 16:87273981-87274003 GATGAGCCTCAGAGAGGTTTAGG + Intronic
1142886692 17:2917157-2917179 GAAGAACCTCAGAGGGGTCCAGG - Intronic
1143451963 17:7042011-7042033 GATGAGCCTCGGGGGGCTCCTGG - Exonic
1146176106 17:30667572-30667594 GGGGAACCTCTGAGGGTTCTGGG + Intergenic
1146349563 17:32083682-32083704 GGGGAACCTCTGAGGGTTCTGGG + Intergenic
1147335162 17:39723312-39723334 GATGGACGTCAGAGGGCTGGGGG - Exonic
1147438535 17:40432486-40432508 CATTGCCCTCAGAGGGCTCTTGG + Intergenic
1148355847 17:46975311-46975333 GATAAATCTCAGAGGGCCTTGGG - Intronic
1148614544 17:48990190-48990212 GAAGAACCTAAGAGAGCTCTTGG + Intergenic
1148680493 17:49470713-49470735 GATGAAGCTCAGAGCACCCTGGG - Intronic
1149974686 17:61253653-61253675 GATGAATCTCGGATGCCTCTGGG + Intronic
1150132365 17:62676017-62676039 TGTGAACCTCAGTGGGCTCCAGG + Intronic
1150425785 17:65075997-65076019 AATGAACATTAGAGGGCTCAGGG - Intergenic
1150739047 17:67764897-67764919 GGTGACCCTCACAGGGCTCAGGG - Intergenic
1152289046 17:79428450-79428472 GACCAGCCTAAGAGGGCTCTAGG - Intronic
1152596048 17:81238387-81238409 GCTGGACCTCAGAGGGGGCTGGG - Intronic
1153666281 18:7370009-7370031 CAGGAAGGTCAGAGGGCTCTGGG + Intergenic
1162006827 19:7786552-7786574 GATGAACCTGAGATGGTTCTGGG + Intergenic
1162982717 19:14249335-14249357 GGGGAACCTCGGAGGGTTCTGGG - Intergenic
1167420744 19:49401536-49401558 GATGATTCTGAGAGTGCTCTGGG + Intronic
925470592 2:4157155-4157177 GATGAACCACAGAGGGACATAGG + Intergenic
929997283 2:46836571-46836593 GAGGAACCTCAGAGGTCACTGGG + Intronic
932434741 2:71696428-71696450 GATGAGCCACAGAGGGCTGAAGG - Intergenic
933896021 2:86809831-86809853 AACGAACCTCAGAGGGACCTTGG - Intergenic
934549478 2:95247208-95247230 GTTGAAGCTCAGATGGCTGTAGG - Intronic
934564403 2:95330364-95330386 GATGGCCCTCAGAGGCCACTGGG - Intronic
934619931 2:95797718-95797740 GAGGAACCTCCTGGGGCTCTGGG + Intergenic
934640957 2:96026839-96026861 GAGGAACCTCCTGGGGCTCTGGG - Exonic
938798118 2:134735634-134735656 GAAGAATTTCAGTGGGCTCTAGG + Intergenic
940383931 2:153048317-153048339 GCTGAAGCTCAGATGGCTGTAGG - Intergenic
940692757 2:156940016-156940038 GTTGAGCCTCAGACTGCTCTAGG - Intergenic
1168793754 20:597419-597441 CATGAACCACACAAGGCTCTAGG - Intergenic
1169108013 20:3013768-3013790 GCTGAATCTCAGTGGGCTCTAGG - Intronic
1169488796 20:6054386-6054408 GAGGATCCTCAGAAGGGTCTGGG + Intergenic
1170329496 20:15192777-15192799 GATAAACAGCAGAGGGTTCTAGG + Intronic
1171170990 20:23015206-23015228 GCTTAGCCTGAGAGGGCTCTTGG + Intergenic
1172134803 20:32679774-32679796 GATGGATGTCAGTGGGCTCTGGG - Intergenic
1172205717 20:33161600-33161622 GATGAACCCCAGAGAGAACTTGG + Intergenic
1172390267 20:34560823-34560845 CATGGACCTCAGGGGGCTGTGGG - Exonic
1172973174 20:38888237-38888259 GAGGAGGCTCAGAGGGCTCAGGG + Intronic
1173922741 20:46758267-46758289 GATGAACAGCAGAGGGCGCGAGG + Intergenic
1179218366 21:39386104-39386126 GTTGAATCTCAAAGGGCACTCGG - Intronic
1181644453 22:24223491-24223513 GAAGACCCTCTCAGGGCTCTCGG - Intronic
1182335123 22:29578951-29578973 GTTGAGGCTCAAAGGGCTCTGGG - Intronic
1182547888 22:31086070-31086092 AATGTACCACAGAAGGCTCTAGG + Intronic
1182685143 22:32116619-32116641 GAATAATTTCAGAGGGCTCTGGG - Intergenic
1183024813 22:35057229-35057251 GTTGAAGATCAGATGGCTCTAGG - Intergenic
1183345363 22:37304483-37304505 ATTGAAGCTCAGGGGGCTCTGGG - Intronic
949328669 3:2896347-2896369 CATGAAGCTCTGAGGGTTCTTGG - Intronic
953600577 3:44359838-44359860 GTTGAACCTGAGAGTGGTCTTGG + Intronic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
954569538 3:51629142-51629164 TATCAAACTCAGATGGCTCTAGG - Intronic
954760010 3:52867147-52867169 CATGAACCTGGCAGGGCTCTTGG + Intronic
955267198 3:57456308-57456330 GATGAGCTCCATAGGGCTCTCGG + Intronic
955941039 3:64147233-64147255 GAGGAGCTGCAGAGGGCTCTGGG + Exonic
956853667 3:73255388-73255410 GAAGAACCTCATGGAGCTCTGGG - Intergenic
957566036 3:81885098-81885120 GGTGAATGTCAGTGGGCTCTTGG + Intergenic
961571998 3:127805978-127806000 GCTTAACCTCAGAGGGCTGCAGG - Intronic
961650212 3:128413404-128413426 CAGGGACCTCAGAGGGCACTGGG + Intergenic
962343902 3:134606198-134606220 GGTGAATCTCAGGGGGATCTGGG - Intronic
962677540 3:137768053-137768075 GATGAAGCTTACAGGGCTCTGGG + Intergenic
962942974 3:140142359-140142381 GATGAGGCTCAGAGGACTGTGGG + Intronic
963827538 3:149971045-149971067 GACGAACCTCAGAGCGCGCTCGG + Exonic
964730107 3:159856215-159856237 CAGGAACATGAGAGGGCTCTTGG - Intronic
965695310 3:171401792-171401814 TATCAACCTCATAGGGCTGTTGG + Intronic
965848504 3:172992721-172992743 GATGAACATCAGAAGACTCAAGG + Intronic
966681212 3:182643794-182643816 AATGAAGCCCAGAGGGCTCGTGG - Intergenic
968072540 3:195794939-195794961 GCTGAACCGCAGAGCCCTCTGGG + Intronic
968951625 4:3697886-3697908 GAGTGACCTCAGAGGGTTCTTGG + Intergenic
969191502 4:5524747-5524769 GATCAACCTGAGAGGGTTGTTGG + Intronic
969486542 4:7475394-7475416 GATGGACCTCAGAGGCATCCGGG - Intronic
971558356 4:28041661-28041683 GATGGACCACAGTTGGCTCTGGG - Intergenic
974221185 4:58973689-58973711 GTTGAACCTCAGATGGTTGTAGG + Intergenic
977034592 4:91933784-91933806 GAAGAACCTCAGAGAGGTCAGGG - Intergenic
980069587 4:128229356-128229378 GATGAAACTCACAGGCATCTGGG - Intergenic
982127819 4:152199626-152199648 TATGGACCTTAGAGGGCTGTTGG + Intergenic
986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG + Intergenic
986580991 5:9265459-9265481 GTTGAACATCACAGGGCTGTGGG - Intronic
987958149 5:24766850-24766872 AATGACCCTCAAATGGCTCTAGG + Intergenic
989399564 5:40994216-40994238 AATGAACCACAGAGGGCCCTGGG + Intergenic
989999123 5:50872536-50872558 TATGTACCTCAGAGGGTTGTGGG - Intergenic
991027606 5:62047340-62047362 GTTGAACATCAGATGGCTGTAGG + Intergenic
992074081 5:73174914-73174936 GATGAACATGGGTGGGCTCTTGG + Exonic
992826529 5:80554762-80554784 GAATAACTTCAGTGGGCTCTGGG + Intergenic
995911236 5:117189537-117189559 GATGCACCTCACAGTGCTCCTGG + Intergenic
997396921 5:133568459-133568481 GATGAAACTAAGAGGGCACTGGG + Intronic
999166312 5:149551925-149551947 GAGGAATCTCTCAGGGCTCTCGG + Intronic
1000335418 5:160238289-160238311 GAACAACCTCACAGGGCTGTTGG + Intronic
1001879155 5:175228194-175228216 GATGACTCTTAGTGGGCTCTTGG + Intergenic
1006248744 6:32762469-32762491 AGTGAACCTCACAGGGCACTTGG - Intronic
1008804190 6:55407755-55407777 GATGAACAAGAGAGGGCTTTTGG + Intergenic
1013416622 6:109931408-109931430 GAGAGATCTCAGAGGGCTCTTGG + Intergenic
1014164012 6:118203223-118203245 TATGAACCTCAGAGAGCAGTTGG - Intronic
1015058123 6:128929205-128929227 GAAGAAGCTCAGAAGGCGCTGGG - Intronic
1021593211 7:22287414-22287436 GATGAACCTAAGAGGGAACCAGG + Intronic
1022119816 7:27297392-27297414 GATTAATCTCAGAGGGCGATGGG - Intergenic
1024181775 7:46902523-46902545 GATGACCCTCTGTGGTCTCTAGG - Intergenic
1024755564 7:52526077-52526099 GATGAAGCCCAGAGGGCTGCTGG + Intergenic
1025757290 7:64357099-64357121 CAGGAGCCTCAGAGGGCCCTGGG + Intergenic
1026892510 7:73990507-73990529 GATGAACCTCAGAGCCATTTGGG - Intergenic
1028043853 7:86091399-86091421 GAATAACATCAGAGGCCTCTAGG + Intergenic
1029742347 7:102497948-102497970 GCTGAACCACTGAGGGCTGTGGG + Intronic
1029760337 7:102597113-102597135 GCTGAACCACTGAGGGCTGTGGG + Intronic
1030251543 7:107450887-107450909 GTTGAACCTCATGGGGTTCTGGG - Intronic
1031986979 7:128169523-128169545 GAGCATCCTCAGAGGTCTCTGGG - Intergenic
1032667469 7:134051339-134051361 GAAGAAACTCAGAGGGAGCTGGG + Intronic
1035995697 8:4544192-4544214 GAGGAAACTCAGATGGCTTTAGG - Intronic
1036792530 8:11730936-11730958 GCTGCACCTCAGTGGGCACTGGG - Intronic
1037746920 8:21652946-21652968 GAAGAACTCCACAGGGCTCTAGG - Intergenic
1037760092 8:21736075-21736097 TAAGACCCTCAGAGAGCTCTTGG - Intronic
1037877494 8:22555098-22555120 GAGGTTCCTCAGAGGCCTCTGGG + Intronic
1038646517 8:29366357-29366379 GAGGAATCACAGATGGCTCTGGG - Intergenic
1040559700 8:48513777-48513799 GACTACCCTCACAGGGCTCTGGG - Intergenic
1040708455 8:50158394-50158416 GATGACCATCAGAGAGCACTGGG + Intronic
1041299252 8:56393780-56393802 GAATAACTTCAGGGGGCTCTAGG - Intergenic
1041301029 8:56411565-56411587 GATGGAGCCAAGAGGGCTCTGGG - Intergenic
1049812157 8:144580430-144580452 GCTCAGCCTCAGAGGGTTCTGGG - Intronic
1050788387 9:9434212-9434234 GAAGAAGCTCAGAGAGATCTAGG - Intronic
1051271776 9:15362406-15362428 GCGAAACTTCAGAGGGCTCTTGG + Intergenic
1052750706 9:32486748-32486770 GATGAAGCTCAGAGGGCAGGAGG + Intronic
1056602196 9:88055018-88055040 GAGGAGCCGCAGAGGGCTCAGGG + Intergenic
1059771080 9:117426526-117426548 GATCAACATCAGTGGGCTCTGGG - Intergenic
1059796399 9:117701820-117701842 GAATAACCTCAGTGGGCTCTGGG + Intergenic
1185649315 X:1637180-1637202 GATGGACCTCACAGGACACTGGG - Intronic
1185649579 X:1638659-1638681 GATGGACCTCACAGGACACTGGG - Intronic
1185649723 X:1639482-1639504 GATGGACCTCACAGGACACTGGG - Intronic
1185649854 X:1640224-1640246 GATGGACCTCACAGGACACTGGG - Intronic
1185650002 X:1641047-1641069 GATGGACCTCACAGGACACTGGG - Intronic
1185650186 X:1642033-1642055 GATGGACCTCACAGGACACTGGG - Intronic
1185650294 X:1642616-1642638 GGTGAACCTCACAGGACGCTGGG - Intronic
1190336445 X:49265609-49265631 GATGAACCCCAGAGGCCCATTGG + Intergenic
1190953340 X:55167662-55167684 GCTTAGCCTGAGAGGGCTCTTGG - Intronic
1191142947 X:57135207-57135229 GATCAACCTGACAGGGATCTGGG - Exonic
1192866322 X:75136737-75136759 GTTGAACATCAGATGGCTGTTGG - Intronic
1193493351 X:82178509-82178531 GTTGAAAATCAGATGGCTCTAGG + Intergenic
1197864211 X:131000701-131000723 GACGAACCTTAGAGGGCTTCTGG - Intergenic
1198051219 X:132955442-132955464 TCTGAAAGTCAGAGGGCTCTAGG + Intronic
1198684568 X:139213925-139213947 TAGAAACCACAGAGGGCTCTGGG + Intronic
1200796551 Y:7346192-7346214 GAGGAGCCCCAGAGGGCTCTGGG - Intergenic