ID: 1137674812

View in Genome Browser
Species Human (GRCh38)
Location 16:50299025-50299047
Sequence CCCGCCCAGGACCTACTTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137674812_1137674829 22 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674829 16:50299070-50299092 GTGGCGGACCCTCCTGGGCATGG 0: 1
1: 0
2: 1
3: 19
4: 168
1137674812_1137674822 6 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674822 16:50299054-50299076 CCCTGGGTCCTGCCCTGTGGCGG 0: 1
1: 0
2: 7
3: 73
4: 519
1137674812_1137674830 26 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674830 16:50299074-50299096 CGGACCCTCCTGGGCATGGTAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1137674812_1137674817 -10 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674817 16:50299038-50299060 CCTGGGCGGGCCCAGGCCCTGGG 0: 1
1: 0
2: 2
3: 57
4: 504
1137674812_1137674831 27 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674831 16:50299075-50299097 GGACCCTCCTGGGCATGGTAGGG 0: 1
1: 1
2: 0
3: 21
4: 207
1137674812_1137674825 16 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674825 16:50299064-50299086 TGCCCTGTGGCGGACCCTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 143
1137674812_1137674832 28 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674832 16:50299076-50299098 GACCCTCCTGGGCATGGTAGGGG 0: 1
1: 0
2: 1
3: 24
4: 254
1137674812_1137674820 3 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674820 16:50299051-50299073 AGGCCCTGGGTCCTGCCCTGTGG 0: 1
1: 0
2: 8
3: 122
4: 800
1137674812_1137674826 17 Left 1137674812 16:50299025-50299047 CCATCAAGTAGGTCCTGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1137674826 16:50299065-50299087 GCCCTGTGGCGGACCCTCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137674812 Original CRISPR CCCGCCCAGGACCTACTTGA TGG (reversed) Exonic
901091552 1:6645025-6645047 CCAGGCCAGGACTTACTTGAGGG + Exonic
903474534 1:23610484-23610506 CTAGCCCAGGAGCTCCTTGAGGG + Intronic
905797173 1:40822396-40822418 CCCCAGCAGGACCTACCTGAAGG - Exonic
906695270 1:47819241-47819263 CCCGCCCTGGAGCGACTGGAGGG - Intronic
907547889 1:55278033-55278055 CTCTCCCAGGGACTACTTGATGG - Intergenic
916047837 1:161013880-161013902 CCAGCGCAGGACTTACTTCAGGG + Intronic
919897522 1:202018490-202018512 CCAGCCCAGGACACACCTGAGGG - Intergenic
923134694 1:231107579-231107601 CCCGGCTGGGAACTACTTGAGGG + Intergenic
924919860 1:248617341-248617363 CCCCCACCGGGCCTACTTGAGGG + Intergenic
1065094090 10:22263662-22263684 CCCGCTCAGGACCTACCTGGAGG + Intergenic
1065368372 10:24956299-24956321 TCTGACCAGGGCCTACTTGAGGG - Intergenic
1070323868 10:75374956-75374978 CCCAACCAGGAGCTTCTTGAGGG + Intergenic
1072207871 10:93220951-93220973 CGAGCCCAGGACCTCATTGACGG - Intergenic
1075521940 10:123148440-123148462 CCCGCCCAGGATGGACTGGATGG - Exonic
1077421747 11:2453741-2453763 CCTCCCCAGAACCTACCTGAAGG + Intronic
1077484005 11:2830627-2830649 CCAGCCCAGGACCTCCTTCCTGG + Intronic
1079343151 11:19629666-19629688 CCTGTCTAGGACCTATTTGAGGG - Intronic
1079979337 11:27132465-27132487 CCGGGACAGGACCTACTTCAGGG - Intergenic
1080458926 11:32437127-32437149 CGGGCCCAGGACTTACTCGAAGG + Intergenic
1085548327 11:77342245-77342267 CCAGACCAGGAACTATTTGAGGG + Intronic
1089751070 11:120651589-120651611 CCAGCCCGGGTCCAACTTGAGGG - Intronic
1095494103 12:42766787-42766809 CCCGCCCAGGAACTTCTTCTTGG + Intergenic
1103271911 12:119680449-119680471 CCTGCCCTGGTCCTGCTTGAAGG + Exonic
1103624377 12:122206960-122206982 CCAGCCCAGGACCTCCTGGTGGG + Exonic
1104383623 12:128329524-128329546 CCAGCCCAGGATCTACTGGGGGG + Intronic
1105779601 13:23695319-23695341 CCCGCCCAGGCCTTTCTGGAGGG - Intergenic
1108130433 13:47293539-47293561 AGACCCCAGGACCTACTTGAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122970634 14:105150764-105150786 CCCGCCCAGGACCTGGTGAACGG - Exonic
1124370926 15:29104228-29104250 CCCGTGCAGGACCCCCTTGAGGG + Intronic
1125834511 15:42737358-42737380 CCCGCCCTGGAGCGACCTGAAGG + Intergenic
1126693899 15:51309858-51309880 CTCGCCCATGAGCTACTTGAGGG + Intronic
1126857893 15:52856665-52856687 CCCTCCCAAGCCCTTCTTGAGGG + Intergenic
1128315568 15:66657260-66657282 CCCACCCAGGACCCACTAAATGG - Intronic
1132150341 15:99454269-99454291 CCCTCCCAAGACCTGCTGGATGG - Intergenic
1132787472 16:1665839-1665861 GCCTCCCAGGAGCTACTGGAAGG - Intronic
1137055942 16:35746746-35746768 CCAGCCCAGGACCTCCTTTTGGG + Intergenic
1137674812 16:50299025-50299047 CCCGCCCAGGACCTACTTGATGG - Exonic
1138269939 16:55688548-55688570 ACTGCCCAGGACCTACTCTAAGG - Intronic
1140067913 16:71626191-71626213 CCCGCCCGGGAGCGACCTGAGGG - Exonic
1141482023 16:84313147-84313169 CGGGCCCAGGACCTACCTGGCGG - Exonic
1148576295 17:48713771-48713793 CCAGCCCAGGAACTGCTTGCAGG + Intergenic
1148686481 17:49503851-49503873 TCCTCCCAGGACCTAAATGATGG + Intronic
1148759993 17:49994667-49994689 CCAGCCCAGGACCCAGGTGAGGG - Exonic
1152388484 17:79989277-79989299 CCCTCCCAGGACCTGCCCGACGG + Intronic
1152942238 17:83178772-83178794 CCCGGCCAGGACCTCCTGCACGG - Intergenic
1157260093 18:46169974-46169996 ATCGCCCAGGACCTGCTAGAAGG - Intergenic
1160580632 18:79882953-79882975 CACGCCCAGGACGTACTCGCGGG + Intronic
1160943613 19:1631151-1631173 CCCTCCCAGAACCTTCTTGGAGG - Intronic
1160961323 19:1722474-1722496 CTGCCCCAGGATCTACTTGATGG + Intergenic
1163255303 19:16152635-16152657 CCGGCCCAGGCCTTACTTGTAGG - Exonic
1164079054 19:21846985-21847007 TACGCCCAGCACCTACCTGATGG - Intronic
1167598430 19:50439520-50439542 TCAGCCCAGGACCTAGTAGACGG - Intronic
1167598442 19:50439594-50439616 TCAGCCCAGGACCTAGTAGACGG - Intronic
1167598454 19:50439668-50439690 TCAGCCCAGGACCTAGTAGACGG - Intronic
925033139 2:666743-666765 CCTCCCCAGGACCGACTTGCTGG + Intergenic
925576864 2:5369352-5369374 TCCTCCCAGGACATCCTTGAGGG - Intergenic
927828787 2:26330209-26330231 CCGGCCCGGGACCTGCGTGATGG + Intronic
928136825 2:28694039-28694061 CCCACCCAGGACCTACTTCTTGG - Intergenic
931241859 2:60461208-60461230 CTCGCCCAGGACCTGGTGGAAGG + Exonic
933161308 2:79027247-79027269 CCTGCCCAGGAAGTACTTTAGGG + Intronic
933174202 2:79158228-79158250 CCTGCCCAGGAAGTACTTCAGGG - Intronic
933895959 2:86809594-86809616 CGGGCCCAGGGCCTTCTTGAGGG - Intergenic
935898593 2:107765127-107765149 CTTGCCCAGGAGCTACCTGAAGG + Intergenic
936403139 2:112181549-112181571 CCCGTCCAGGGCCTACGCGAAGG - Intronic
948916648 2:241037717-241037739 TCAGCCCAGGACCAGCTTGAGGG + Intronic
1169019099 20:2315449-2315471 ACAGCCCAGGACCTCCTGGAAGG + Intronic
1179788361 21:43741881-43741903 CACGCCAAGGCCCTCCTTGAAGG - Intronic
1180676427 22:17589611-17589633 CTCGCCCAGGCCTTTCTTGAGGG - Exonic
1181786141 22:25228598-25228620 TCCTCCCAGGACCTACTGGAAGG + Intronic
1181818316 22:25456428-25456450 TCCTCCCAGGACCTACTGGAAGG + Intergenic
1184786967 22:46676662-46676684 CCCGCCCGGCACCTACTTTCTGG - Exonic
954468026 3:50668530-50668552 CAAGCCCAGGATCTCCTTGAGGG + Intergenic
958838047 3:99170429-99170451 CAGACACAGGACCTACTTGATGG + Intergenic
961812977 3:129532406-129532428 CCCGGCCCGTACCTCCTTGACGG - Exonic
971166014 4:24184530-24184552 CCCAGGCAGGACCTAGTTGAAGG + Intergenic
975690372 4:76957108-76957130 ACCACCCATGACTTACTTGATGG - Intronic
985577760 5:681634-681656 CCTGGCCAGGACCTGCTTGGAGG + Intronic
987021622 5:13878428-13878450 CCCGCCTAGTGTCTACTTGATGG + Intronic
996599162 5:125241538-125241560 CAGACCCAGGGCCTACTTGAGGG - Intergenic
1002009430 5:176265149-176265171 CCCTCCTAGGACCTAATTGAGGG + Intronic
1002217296 5:177647138-177647160 CCCTCCTAGGACCTAATTGAGGG - Intergenic
1013430285 6:110049456-110049478 GCCTCCCTGGAGCTACTTGAGGG - Intergenic
1016965785 6:149717833-149717855 CCAGCCCCGGACCTACCTGGAGG + Exonic
1018837944 6:167498976-167498998 CCTGCCCAGGACCTGCTGGCCGG - Intergenic
1020260163 7:6526555-6526577 CCCGCGCAGGGCCTCCTTGCTGG - Exonic
1025745993 7:64243321-64243343 CTGGCCCAGCACCTAGTTGATGG - Intronic
1029033198 7:97490502-97490524 CCCGCCCTGCACCTGGTTGATGG - Intergenic
1029355717 7:100049993-100050015 CCCGCCCAGGACCAGCTGGTGGG + Intronic
1032966046 7:137099306-137099328 AACCACCAGGACCTACTTGAGGG + Intergenic
1035272662 7:157729657-157729679 CCCTCCCAGGACCTCCCTGCAGG - Intronic
1040290169 8:46120166-46120188 CCCGCCCAGGACAGTCCTGAGGG + Intergenic
1040313792 8:46250366-46250388 CCCGCCCAGGTCAGACTTGGGGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040634919 8:49261789-49261811 AGAGGCCAGGACCTACTTGAAGG + Intergenic
1059338458 9:113583744-113583766 CCCTGCCAGGACCTACCTGCTGG + Exonic
1060355665 9:122905094-122905116 CCCGCCCCCGCCCTACCTGAGGG + Intronic
1061059492 9:128243456-128243478 CCTGCCCAGGACAAACTTGGAGG - Intronic
1192432488 X:71121810-71121832 CCCGCCTAGTACCTACCTGTAGG - Exonic
1198980891 X:142394523-142394545 AAAGCCCAGGACCTACCTGATGG - Intergenic