ID: 1137681553

View in Genome Browser
Species Human (GRCh38)
Location 16:50350887-50350909
Sequence CAGAAGCTCTTGGGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137681543_1137681553 26 Left 1137681543 16:50350838-50350860 CCAATGCGGGGAAGAAGCGGGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG 0: 1
1: 0
2: 1
3: 26
4: 390
1137681545_1137681553 -7 Left 1137681545 16:50350871-50350893 CCTAGACCCACTGTACCAGAAGC 0: 1
1: 2
2: 8
3: 148
4: 783
Right 1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG 0: 1
1: 0
2: 1
3: 26
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137681553 Original CRISPR CAGAAGCTCTTGGGGAAGAA GGG Intronic
900586980 1:3437314-3437336 CAGACGCTCATGGGGAAGCGGGG - Exonic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
900999356 1:6140673-6140695 CAGAAGCTCTTTTGGAAATAGGG + Intronic
901216058 1:7556017-7556039 CAGGACCACTTGGGGAAGCAGGG + Intronic
901405116 1:9040108-9040130 CTGGGGCTCTCGGGGAAGAAGGG + Exonic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
903677632 1:25074428-25074450 AAGAATCTATTGAGGAAGAAAGG + Intergenic
904052826 1:27650490-27650512 CAGAAGCCCTAGGGAAATAAAGG + Intergenic
904989230 1:34578148-34578170 CAGGAGCACTTGCAGAAGAAAGG - Intergenic
905590017 1:39155170-39155192 AAGAGGCTCTTGGGAAAGGAGGG - Intronic
905975059 1:42168558-42168580 CAGAGGGGCTTGGGGAACAAGGG - Intergenic
906202285 1:43967809-43967831 CAGAAGGCCTGGGGGAAGGATGG + Exonic
906848921 1:49226567-49226589 CAGAAGTTCTTGTGCAAAAATGG + Intronic
906913498 1:49982539-49982561 CAGAAAGGCTTGGGGCAGAAAGG + Intronic
907291842 1:53419235-53419257 CACAAGCTATTGGCGAAGGAAGG + Intergenic
909100804 1:71345637-71345659 CAGAAGCCTTTAGGGCAGAATGG - Intergenic
909269711 1:73607135-73607157 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
909587908 1:77311989-77312011 CAGGAGCTGTAGGGGAGGAAGGG - Intronic
910177971 1:84451435-84451457 CAGAAACTCCTGGAGAAAAAAGG - Intergenic
912673046 1:111649221-111649243 CAGGAGCACCTGGAGAAGAAGGG - Intronic
913604494 1:120452462-120452484 CAGGACTTCTTGGGTAAGAACGG + Intergenic
914084047 1:144436742-144436764 CAGGACTTCTTGGGTAAGAACGG - Intronic
914190068 1:145402014-145402036 CAGGACTTCTTGGGTAAGAACGG - Intronic
914277116 1:146135154-146135176 CAGGACTTCTTGGGTAAGAACGG - Intronic
914538161 1:148586102-148586124 CAGGACTTCTTGGGTAAGAACGG - Intronic
915277788 1:154801465-154801487 CGTAGGCTCTTGGGGAAGAATGG - Intronic
915458878 1:156057904-156057926 GAGAAGCCTTTGGGGAAGGAGGG + Intronic
915509269 1:156377700-156377722 CCACAGCTCTTGGGGAACAAGGG - Intronic
915665314 1:157439153-157439175 CAGAAGGTGATGGGGAAGGAAGG + Intergenic
916123170 1:161547345-161547367 AACAAGCTTTGGGGGAAGAAGGG - Intronic
916133062 1:161628703-161628725 AACAAGCTTTGGGGGAAGAAGGG - Intronic
916667722 1:166981674-166981696 CAGAATTTCTAGGGGCAGAAAGG + Intronic
916668525 1:166989720-166989742 CAGAAGCTTTTGGGGATTGAAGG - Exonic
917593970 1:176508839-176508861 CAGAAGATGATGGGGAAGCAAGG - Intronic
917636446 1:176941652-176941674 CTGAAGCTTTTGGGGAGGAGAGG - Intronic
920172378 1:204080118-204080140 CCAAAGCTATTTGGGAAGAAAGG - Intronic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
923503100 1:234582702-234582724 CAGAGCCTCCTGGGGAGGAATGG - Intergenic
923570755 1:235111981-235112003 GAGCAGCTCTGGGGGAATAAGGG - Exonic
923648902 1:235853525-235853547 CAGTAGTTCTGGGGGAAGAATGG + Intronic
923952911 1:238980178-238980200 CAGAAGCTAGTGGGGAGGCACGG + Intergenic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1065223544 10:23520319-23520341 TACAAGATCTTGGGGCAGAAAGG + Intergenic
1065315298 10:24458031-24458053 CAGAGCCTGGTGGGGAAGAAGGG + Intronic
1066094175 10:32056588-32056610 CAGAAGTTCCTGGGGAGGCAGGG + Intergenic
1066449109 10:35511952-35511974 CAGTAGCACTTGAAGAAGAATGG + Intronic
1067673122 10:48344345-48344367 CAGTAGCTCTTTAGGAATAAAGG - Intronic
1067712588 10:48661854-48661876 CAAAAGCCCTGGGGCAAGAAAGG - Intergenic
1067918079 10:50422023-50422045 CAAAAGTTCTAGGAGAAGAAAGG - Intronic
1068727774 10:60322571-60322593 GAAAAGGCCTTGGGGAAGAAAGG - Intronic
1068779063 10:60899943-60899965 CAGAAGCCCTTGGGGAAGGGAGG + Intronic
1069080270 10:64081215-64081237 CAGTAACTCTTGGGCAAGACAGG + Intergenic
1070996750 10:80790536-80790558 CAGAGGCTAGTGGGGAGGAAGGG - Intergenic
1071676542 10:87660322-87660344 GAAGAGCTCTTGGGAAAGAAAGG - Intronic
1073618785 10:105025428-105025450 TAGAATCTCCTTGGGAAGAAAGG - Intronic
1074239213 10:111620573-111620595 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1074487682 10:113902751-113902773 CATAACCTCTTGGCAAAGAAAGG - Intronic
1075308766 10:121393008-121393030 AAGTATCTCTTCGGGAAGAATGG - Intergenic
1076640675 10:131914691-131914713 CAGCAGCTTTTGCAGAAGAACGG + Intronic
1077543499 11:3158825-3158847 CAGAAGCCCTTGGAGAAGCCAGG + Intronic
1078285288 11:9947478-9947500 TAGATGCTGATGGGGAAGAAGGG + Intronic
1079586759 11:22135226-22135248 CAGAAGATGATAGGGAAGAAAGG + Intergenic
1079595085 11:22234409-22234431 ATGAAGCTTGTGGGGAAGAATGG - Intronic
1082869808 11:57933764-57933786 CTGCAGCTCTTGGATAAGAAGGG + Intergenic
1084895415 11:72263772-72263794 CAGAAGGTCAAGGGGAAGCAAGG - Intergenic
1085393616 11:76194988-76195010 CAGAAGGAATTGGGGAAGCAGGG - Intronic
1085462113 11:76700462-76700484 CAGATCCTGTTGGGGACGAAGGG + Intergenic
1085513781 11:77100759-77100781 CAGCAGTTCTTGGGGTAGAATGG - Intronic
1085727342 11:78965627-78965649 CAGAAGCCCTGGGGTGAGAACGG + Intronic
1087755111 11:102047300-102047322 CACAAGCTCCTGGGAAAGACAGG + Intergenic
1088067713 11:105741346-105741368 CTGAAGCTCATGGAAAAGAAAGG + Intronic
1088314002 11:108488802-108488824 CATATGTTCTTGGGGAAGACAGG + Intronic
1089776957 11:120844526-120844548 CTGGAGTTCTTGGGGTAGAAGGG + Intronic
1089973606 11:122713797-122713819 CAGTAGGTCTTGGGGAACATGGG + Intronic
1090240270 11:125176719-125176741 AAGAAGATGCTGGGGAAGAAGGG - Intronic
1090632739 11:128664490-128664512 CAGATCCTCTTGGGGCAGATAGG + Intergenic
1091107770 11:132938811-132938833 CAGAGGCTCTAGGGCCAGAAAGG + Intronic
1091333021 11:134745396-134745418 CAGAAGATTTTGGGTAAGACAGG + Intergenic
1091457297 12:617555-617577 CTGAAGCTCCTGGGGATAAAAGG + Intronic
1091653391 12:2326029-2326051 CAGAAACTCTGGGGGCAGCAGGG + Intronic
1095232947 12:39763639-39763661 GAGAAGCTCTTCTGGGAGAATGG + Intronic
1095899530 12:47313674-47313696 CTGAAGACCTTGGGAAAGAATGG - Intergenic
1096116494 12:49058575-49058597 CAGAAGGTATTGGGGAGAAAGGG - Intronic
1096356114 12:50942389-50942411 CAGAAGCAATGGGGGAAGAAAGG - Intergenic
1096634458 12:52949510-52949532 CGGGAGCACTTGGAGAAGAAGGG + Exonic
1097442891 12:59632861-59632883 GAGACACACTTGGGGAAGAAGGG + Intronic
1098029655 12:66240714-66240736 CAGAAGGACCTGGGGAAGAGGGG - Intronic
1098082514 12:66804131-66804153 AAGAAGATCTAGGAGAAGAAAGG - Intronic
1098239887 12:68456218-68456240 CAGGAGCCCGTGGGGAAGACTGG - Intergenic
1098424048 12:70339417-70339439 CAGAATTTCATGGGTAAGAAGGG - Intronic
1098656948 12:73044061-73044083 CAGGAGTTCATGGGGAAGGAGGG + Intergenic
1099842941 12:87989723-87989745 TAGAAGTTCTTGGGGAAATATGG - Intronic
1099889961 12:88579291-88579313 CAGAACCTCTGGGGGGTGAAAGG + Intronic
1100159559 12:91842685-91842707 CAGAAGGTAAAGGGGAAGAAAGG - Intergenic
1100895895 12:99182118-99182140 CAGAAGGTCAAGGGGAAGCAAGG + Intronic
1102000758 12:109556807-109556829 CAGGAGAGCTTGGGGAAGCAGGG + Exonic
1102440753 12:112962571-112962593 CATAAGCACTTGGGGCAGGAAGG - Intronic
1103004139 12:117408312-117408334 GAGCAGCTCCTGGGGAAGGAGGG - Intronic
1103761973 12:123257067-123257089 CAGAAGCTCCCAGGGAATAATGG + Exonic
1103937811 12:124485832-124485854 CAGAAGCTCCTAGAGAAGATGGG + Intronic
1104382399 12:128318959-128318981 CGTAAGCTCTAGGGGAAGTAAGG - Intronic
1104465858 12:128989873-128989895 ATGAGGATCTTGGGGAAGAAAGG - Intergenic
1104943233 12:132404543-132404565 CAGAAGCTCTTGGGGGACCCCGG - Intergenic
1105604773 13:21917866-21917888 CAGAAGCCCTGCGGGAAGGAGGG - Intergenic
1105766417 13:23564516-23564538 CAGGGGCTCTAGGGGAAGGAGGG + Intergenic
1105892195 13:24689771-24689793 CAGGGGTTTTTGGGGAAGAAGGG - Intronic
1106720656 13:32431596-32431618 CAGAAGATCTGGGAGAAGTAGGG + Intergenic
1108879115 13:55087350-55087372 CAAAAGGTCTTGGGGAAGGAGGG - Intergenic
1110743385 13:79023878-79023900 CAGAAGCTATTGGAGGAAAAAGG - Intergenic
1111032521 13:82622632-82622654 CAAATTCTCTTAGGGAAGAAAGG + Intergenic
1112669522 13:101618558-101618580 CAGATGACCTTTGGGAAGAATGG + Intronic
1116375223 14:44190790-44190812 CAGAAGCTGAAGGGGAAGCAAGG - Intergenic
1116694907 14:48161244-48161266 CAGAAGGGCTTGGAGAATAAGGG + Intergenic
1116804887 14:49483888-49483910 CAGCAGCTCTGGGTCAAGAAGGG - Intergenic
1116949654 14:50867684-50867706 TAAAAGCTATTGGGAAAGAAAGG - Intronic
1118365620 14:65093110-65093132 CAGAAGGGAGTGGGGAAGAATGG + Intronic
1118838721 14:69495165-69495187 CAGAAGCACGAGGAGAAGAAGGG + Intronic
1119654161 14:76405053-76405075 CAGAAGCTGTTTGGGAAGGATGG + Intronic
1120281139 14:82439343-82439365 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1120613504 14:86673366-86673388 CAGAAGCTCTTTGAGAGCAAGGG - Intergenic
1121946716 14:98130143-98130165 CAGAAGCTCTGGGGTATAAATGG + Intergenic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122084051 14:99287273-99287295 AAGAGGCTCATGGGGCAGAAAGG - Intergenic
1124843059 15:33262935-33262957 GAGAAGCACTTGGAGGAGAAAGG - Intergenic
1126127542 15:45309495-45309517 TAGCAGCTCTTCGGGAAGAGGGG - Intergenic
1127316253 15:57796928-57796950 CCGAAACACTTGGGGTAGAATGG + Intergenic
1128351673 15:66894953-66894975 TAGAACCAGTTGGGGAAGAAAGG + Intergenic
1128702755 15:69816123-69816145 CAGAAAGTCTTGGAGAGGAAGGG - Intergenic
1128757753 15:70195019-70195041 CAGCAGCTCTCAGGGAAGCAGGG - Intergenic
1128916347 15:71566553-71566575 CAGAAACTCTCGGGGCAGCACGG - Intronic
1129103891 15:73291961-73291983 CAGCAACTCTAGGGGAAGACAGG - Intronic
1129389852 15:75215022-75215044 CAGAGGCTCTTGAAGAAGCAAGG - Intergenic
1129994000 15:79989293-79989315 CAGAAGCCTTTGGGCATGAAGGG - Intergenic
1130037219 15:80371915-80371937 CAGAAGCCCTTTGGGACAAAGGG + Intronic
1131770162 15:95728572-95728594 CAGAAGGTCAAGGGGAAGCAAGG - Intergenic
1132367794 15:101270120-101270142 CTGAGGCCCCTGGGGAAGAAGGG - Intergenic
1132496695 16:266753-266775 CAGAAGGCCTTGGGTATGAAAGG + Intronic
1133180207 16:4048679-4048701 TGGCAGCTCTTGGGAAAGAAGGG - Intronic
1133433982 16:5763483-5763505 AGGAGGCTCTTGGGGATGAAGGG + Intergenic
1133575784 16:7087778-7087800 CAGATACTCTTGGTGAAGTAAGG + Intronic
1133865778 16:9641793-9641815 CAGAAGCTCAAGAGGAAAAAAGG + Intergenic
1134202696 16:12212024-12212046 CAGAAGCACTGGGGAAAGCATGG - Intronic
1134669540 16:16044607-16044629 AAGAAGCTCATGAGGAAGTAGGG - Exonic
1134799004 16:17067388-17067410 CAGAATCTCTTTGGGGAGTAGGG - Intergenic
1136183595 16:28571892-28571914 TAGAAGCTCTCAGGCAAGAACGG - Intronic
1137033664 16:35548568-35548590 CAGAAGATGTTGGAGAAGATGGG + Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1137833056 16:51562604-51562626 TGGAAGCTCTTGGAGAAAAATGG + Intergenic
1138382270 16:56610921-56610943 GATAAGCTCTTGGGGAAAAACGG + Intergenic
1139165955 16:64565671-64565693 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1139274832 16:65717821-65717843 CAGAAGCACTTGGGAAAAAAAGG + Intergenic
1140325408 16:73996591-73996613 CTGTAGCTGTTGGGGAAGAGAGG + Intergenic
1140924962 16:79573472-79573494 CAGAAGATATGGGGGAAGAAAGG - Intergenic
1141458285 16:84159446-84159468 CTGAAGTTCATGTGGAAGAAAGG + Intronic
1141906326 16:87029156-87029178 CAGAAGCTGGTGGGCAAGAGTGG - Intergenic
1142220042 16:88849813-88849835 CTGAAGCTGATGAGGAAGAAAGG + Intronic
1143357397 17:6340590-6340612 CACAAGCACTTGGGGACAAATGG - Intergenic
1143373777 17:6455684-6455706 CAGCAGCGCAGGGGGAAGAAGGG + Intronic
1143838507 17:9712096-9712118 CAGAGGCTGTTGGTGAAGATGGG - Exonic
1144410259 17:14993957-14993979 CAGAGGTTCTTGGGGAAGGATGG - Intergenic
1144591430 17:16527431-16527453 CAGAAGCTGGAAGGGAAGAATGG - Intergenic
1144726703 17:17505959-17505981 CAGTGGCTCTGGGGGATGAAGGG - Intronic
1145871452 17:28276985-28277007 CAGGAGCACCTGGAGAAGAAGGG - Intergenic
1146133077 17:30295023-30295045 GGGAAGCTCTTTGGGGAGAAAGG + Intergenic
1146659544 17:34655398-34655420 CAGAAGCTCTTAGATAAGAAAGG + Intergenic
1147654337 17:42080298-42080320 CAGAAGGTGTTGGGAAGGAAAGG + Intergenic
1148234744 17:45961307-45961329 CTGGGGCTTTTGGGGAAGAAGGG + Intronic
1148698585 17:49575515-49575537 GAGTAGCTCTTGGAGAGGAAGGG - Intergenic
1148978692 17:51551929-51551951 TAGAAGGTCTTGGGCCAGAAAGG + Intergenic
1149358868 17:55871870-55871892 TAGAAACTCTTGGGGAAAGAGGG + Intergenic
1149491744 17:57090088-57090110 CAGAAGGTGTTGGGGGAGAGTGG + Intronic
1149936313 17:60810502-60810524 CAGGAGCACCTGGAGAAGAAGGG + Intronic
1149978865 17:61293332-61293354 CAGAATCTCTTGGAGTAGAGGGG - Intronic
1150028206 17:61701437-61701459 CAGAGACTCTTGGCAAAGAATGG - Intronic
1150208238 17:63425849-63425871 GGGAGGCTCATGGGGAAGAAGGG - Exonic
1151233269 17:72700045-72700067 CAGAAGCTCTTGGGAGACGAAGG + Intronic
1151449793 17:74191566-74191588 CAGAGGCACTTGGGGAGGATAGG - Intergenic
1151743639 17:76000543-76000565 CAGAAGGTCCTGGTGAATAAAGG + Exonic
1152184118 17:78843453-78843475 CACAGGCACTTGGGGAAGACAGG + Intergenic
1152286804 17:79417314-79417336 CTGAAGCTCTCAGGAAAGAAGGG + Intronic
1152764144 17:82126882-82126904 CAGAAGCTGTAAGGTAAGAAGGG + Intronic
1152942414 17:83179742-83179764 GAGTAGCTCTTGCGGGAGAAAGG - Intergenic
1153153763 18:2126102-2126124 CAGAGGGTCTAGGGGAAGCAGGG - Intergenic
1157077133 18:44478468-44478490 CAGAAGGTGATGGGGAAGAAAGG - Intergenic
1157696948 18:49730629-49730651 GGGGAGCTCCTGGGGAAGAAAGG - Intergenic
1157845052 18:50995765-50995787 CAGAAGTGTTTGGAGAAGAAAGG - Intronic
1159103083 18:63976856-63976878 CAGCAACTCTTGGGGAAAATGGG + Intronic
1161649408 19:5475037-5475059 GAGATGCTCTAGGGCAAGAAAGG + Intergenic
1162273540 19:9635571-9635593 CAGAATCTATTGGGGATGGATGG + Intronic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165081395 19:33308856-33308878 CAGAAGATGAAGGGGAAGAAAGG - Intergenic
1165404291 19:35620223-35620245 CAGAAGGTCCTGGCGAAGAGAGG - Exonic
1166912701 19:46171389-46171411 AAGAAGCTATTGGGCAAGAGTGG + Intergenic
1202677357 1_KI270711v1_random:19854-19876 CAGGAGTTCCTGGGTAAGAACGG - Intergenic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
925615781 2:5743485-5743507 CAGGACCTCTTGGTGAAGATAGG + Intergenic
925891824 2:8440536-8440558 CTGAAGCCCTTGGGCAGGAAAGG - Intergenic
926062489 2:9813136-9813158 AAGAAGCTGGTTGGGAAGAAAGG + Intergenic
926062497 2:9813196-9813218 AAGAAGCTGGTTGGGAAGAAAGG + Intergenic
926662481 2:15482556-15482578 CAGAAACTGTTGGGGTGGAAAGG - Intronic
926974208 2:18496997-18497019 CAGAAGGTGATGGGGAAGCAAGG + Intergenic
928452313 2:31387811-31387833 CAGCAACTCTGGGGGAAAAATGG + Exonic
928572163 2:32620492-32620514 GAGAAGTCCTTGGGGAAGGATGG + Intergenic
928725572 2:34170198-34170220 CATAAGCTTATGAGGAAGAAAGG + Intergenic
928853533 2:35777926-35777948 GCTAAGCTCTTGGTGAAGAAAGG + Intergenic
929096749 2:38269731-38269753 GTGAAACTCTTGGGGTAGAAAGG + Intergenic
929375875 2:41286415-41286437 CAGAAGTTCAAGGGGAAGGAGGG + Intergenic
929668159 2:43849831-43849853 CAGAGGCTCTCAGGGTAGAAGGG - Intronic
929989188 2:46770590-46770612 CTGTAGCACTTGGGGAAGAATGG + Intergenic
931167782 2:59768044-59768066 CAAAAGCTCCTGGGGAGGCAAGG - Intergenic
931455948 2:62409923-62409945 CATCAGCTCTTGAGGAAGCAAGG + Intergenic
933698579 2:85238184-85238206 CATAAGTGCATGGGGAAGAAAGG + Intronic
933791199 2:85885312-85885334 CAGAGGCTCTTGGGGAGCTAAGG + Intronic
936982711 2:118278917-118278939 AAGATGCTCTCGGGGAAGCAAGG - Intergenic
939736233 2:145850418-145850440 CAGAATCTCACGGAGAAGAAAGG + Intergenic
940078510 2:149771560-149771582 CAAAAGCTGGTGGGGAAAAATGG + Intergenic
940812636 2:158262626-158262648 CAGAAGGTAAAGGGGAAGAAAGG + Intronic
940854736 2:158721165-158721187 CAGAAGCACTTGGGGGAGGGTGG - Intergenic
941622083 2:167789748-167789770 GAGAAGCTGTAGGGGAGGAAAGG - Intergenic
941913051 2:170784967-170784989 CAGAAGCTGGACGGGAAGAAGGG + Intronic
941923665 2:170875370-170875392 CAGAAGATATGGGGGAAGAAGGG - Intergenic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942189512 2:173456353-173456375 CCGTAGCCCTTGGGGAAGACTGG + Intergenic
942725483 2:179002164-179002186 CTGATGCTCTGGGTGAAGAATGG + Intronic
942953977 2:181752318-181752340 CTGAATCTTTTGGGGAAGAGAGG - Intergenic
945060601 2:205905553-205905575 CAGTGGATCTTGGGGAAGCACGG - Intergenic
945700257 2:213160707-213160729 ATGTAGCTCTTGGGGAAGAGAGG + Intergenic
946549822 2:220789048-220789070 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
947120026 2:226804265-226804287 CAAAATCTCTTAGGGAAGGATGG + Intergenic
947950959 2:234146853-234146875 TAGAACCACTGGGGGAAGAAAGG + Intergenic
948590819 2:239048524-239048546 AAGAAGCTCTTGGGTGAGTAAGG + Exonic
1170081787 20:12484509-12484531 CAGAAGGTGATGGGGAAGCAAGG - Intergenic
1170646260 20:18198642-18198664 TAGAAGGTCTTGAGGAAGCAAGG + Intergenic
1170759152 20:19234547-19234569 CAGACCTTCTTGGGGTAGAAAGG + Intronic
1170873578 20:20231090-20231112 CCTCAGCACTTGGGGAAGAAAGG - Intronic
1171317751 20:24210372-24210394 GAGAACCTCTTTGGAAAGAATGG - Intergenic
1172180410 20:33000097-33000119 CAGAAGCTCATGGAGAAGACAGG - Exonic
1172240822 20:33411460-33411482 CAGGAGCAGATGGGGAAGAAAGG - Intronic
1173171291 20:40726202-40726224 CAGAACCTCTTGGGGAGGTGGGG - Intergenic
1173191729 20:40882063-40882085 CAGAATCTCTTGGGGAATCCAGG + Intergenic
1173395788 20:42678125-42678147 CAGCAGCTCTGGGGGAGCAATGG + Exonic
1175236167 20:57513754-57513776 CAGAATCTCTTTGGGCAAAAGGG + Intronic
1175366321 20:58458745-58458767 CTGAAGGTCTGGGGGAAGAGAGG + Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1179012482 21:37566462-37566484 CAGGCCCTCTGGGGGAAGAAGGG + Intergenic
1179171525 21:38976676-38976698 CGGATGCTCTTGGGTAACAAAGG + Intergenic
1179567794 21:42260077-42260099 CAGCAGCTCATGGGGCAGGAAGG + Intronic
1179628178 21:42660183-42660205 CAGAAGGTTTTGGGCAAGAAGGG + Intronic
1179923795 21:44521669-44521691 CAGAGGCTCTCAGGCAAGAAGGG + Intronic
1179942866 21:44650935-44650957 CAGATGCTCTGGGGGAGGACAGG + Intronic
1180655772 22:17419227-17419249 CAGAAGCTCCCGCGGAAGACTGG + Intronic
1180689885 22:17704717-17704739 GAGCAGCTCTGGGGGAATAAGGG + Intronic
1181092501 22:20483747-20483769 CAGAAGCACTTGGAGAAGAAGGG - Intronic
1182481999 22:30615180-30615202 CAGGAGGGCTTGGAGAAGAAGGG - Intronic
1182499629 22:30736996-30737018 CAGAAGTTCCTGTGGAAAAATGG - Intronic
1183086267 22:35489212-35489234 CAGCAGCCCGTGGGGGAGAAGGG - Intergenic
1183735751 22:39643937-39643959 CACAGGCTCGTGGGGAAGATGGG + Intronic
1183775340 22:39960411-39960433 CAGAAGCACCTGGGCTAGAAGGG - Intronic
1184303746 22:43580182-43580204 CAGAGGCCCTTGGGCAAGAGTGG - Intronic
1185223136 22:49639247-49639269 CAGAGGCTCCTGGGGAGGGAGGG + Intronic
950156728 3:10726579-10726601 CAGAGTCTCTTAGGGAAGACAGG - Intergenic
951494412 3:23310498-23310520 GAAAAGCTGTTGGAGAAGAATGG + Intronic
953030663 3:39177825-39177847 CAGAAGCTTGTGGGGGAGAAAGG - Intergenic
953199784 3:40768477-40768499 CAGAATGTCTTGAGGAAAAAAGG + Intergenic
953569368 3:44058939-44058961 CAGAGGCTCACGGGGAAGAGTGG + Intergenic
954300635 3:49699138-49699160 CAGAAGCTCTTGGGGAGGCTGGG + Intronic
954398009 3:50303236-50303258 CAGTGGCTCATGGGGAAGCAGGG - Exonic
954644067 3:52120031-52120053 GGGAAGCCCTTGGGCAAGAAGGG + Intronic
955516651 3:59732575-59732597 GAGAAGCTCTGGGGGCAGGATGG - Intergenic
955531737 3:59880242-59880264 CACAAGGTCTTGGGGAGGGAAGG - Intronic
955858124 3:63296438-63296460 GAGAACCTCTTGCGTAAGAACGG - Intronic
956619208 3:71203916-71203938 CAGAAGCTCATGGAAAAGGAAGG + Intronic
956655319 3:71544560-71544582 CTGAAGCACTTGGGAAGGAATGG + Intronic
958828149 3:99057228-99057250 CATAAACTCTTGGTGAAGTAGGG + Intergenic
959620359 3:108393242-108393264 CAAAAGCTCTTGATGGAGAAGGG + Intronic
959780684 3:110229512-110229534 CAGAAGATCCAGAGGAAGAAGGG - Intergenic
960614251 3:119582360-119582382 CAGAAGCTCTTGTGGAAGCTGGG + Exonic
961853037 3:129840734-129840756 CAGAAGGTGAAGGGGAAGAAAGG - Intronic
962506627 3:136052833-136052855 CAGAAGGGCTTGGGAAAGAATGG - Intronic
962901954 3:139769202-139769224 CAGAACCTGTTGGGGGAGAGGGG + Intergenic
963039340 3:141057123-141057145 TGTGAGCTCTTGGGGAAGAAAGG + Intronic
963163322 3:142174972-142174994 CAGAAGCTATGGAGGAAGAAAGG + Intronic
963165076 3:142193169-142193191 CAGAAACTGTTGGGGAGTAAGGG + Intronic
965404731 3:168254949-168254971 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
972090995 4:35283442-35283464 CAGAAGGTGTAGGGGAAGCACGG - Intergenic
972281354 4:37604674-37604696 CAGAAGCGGGTGGGGAACAAAGG + Intronic
972420428 4:38881491-38881513 CAGAAGCTCAGAGGGAACAAAGG + Intronic
972736584 4:41847867-41847889 CAGAATATCTTTAGGAAGAACGG - Intergenic
973981824 4:56314301-56314323 CAGGAGCTCTTGGAGGAGGAGGG + Exonic
979447556 4:120832547-120832569 CACAAGCTCATGGGGAAGTGAGG - Intronic
979653268 4:123161423-123161445 CACTAAGTCTTGGGGAAGAAAGG + Intronic
979784922 4:124704575-124704597 CTGAAGCTCTTGAATAAGAAAGG - Intronic
980596297 4:134959648-134959670 CAGGATCTCTTGGGTAATAAAGG + Intergenic
981748658 4:148073359-148073381 AACAACCTCTTGGGGAAGAGGGG + Intergenic
981930712 4:150186082-150186104 CAGAAGCTCATCAGGAATAATGG - Intronic
982387885 4:154832510-154832532 CACAAGCCTTTGGAGAAGAAGGG + Intergenic
982693092 4:158570388-158570410 GTGAAGCTCTTGGGTAAGGATGG + Intronic
983022708 4:162699413-162699435 CAGAAGGTGATGGGGAAGCAAGG - Intergenic
983066758 4:163219211-163219233 CAGAATCTCTAGGTGATGAATGG + Intergenic
983335189 4:166382980-166383002 CAGTAGCTCCTGGGAAACAAGGG + Intergenic
983935513 4:173500299-173500321 CCGCAGCTCTTGGGGGAGCAGGG - Intergenic
986384370 5:7217201-7217223 CAAAAACTCCTGTGGAAGAAAGG + Intergenic
988136372 5:27176276-27176298 CAGAAGGTGAAGGGGAAGAAGGG + Intergenic
988233470 5:28508497-28508519 GAGATGCTTTTGGGGAAGGATGG + Intergenic
988787286 5:34576873-34576895 CACAAGCTCTTATGGGAGAAGGG - Intergenic
989311825 5:40027573-40027595 CAGAAGCTGAAGGGGAAGGAAGG + Intergenic
990918115 5:60932894-60932916 CAGAAGAGCCTGGGGTAGAAGGG + Intronic
991120476 5:63007950-63007972 CAGAAGGTGATGGGGAAGCAAGG + Intergenic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
991980332 5:72223894-72223916 CAAAAGCACATGGTGAAGAAAGG + Intronic
992050885 5:72939600-72939622 CAGAGGCTGAGGGGGAAGAATGG + Intergenic
992202881 5:74401489-74401511 AGGAAGCTCTTGGGGAGGATGGG - Intergenic
993544179 5:89190631-89190653 CAGAAGCTTTTCCGGAAAAAAGG - Intergenic
995837119 5:116410030-116410052 CAGGAGCTAATGGAGAAGAAAGG - Intronic
996452031 5:123636446-123636468 CGGTAGCACTTGGAGAAGAAGGG + Intergenic
997236263 5:132273997-132274019 CAGAAGATCTATGAGAAGAAAGG - Intronic
999004540 5:147961403-147961425 CAAAAGCCCTTGGGCAGGAATGG - Intergenic
1001477289 5:172059676-172059698 AAGGAACTCTTGGGCAAGAAGGG - Intronic
1001721745 5:173862551-173862573 CAGAAGGTGATGGGAAAGAATGG + Intergenic
1001913778 5:175542461-175542483 CAGAGCCTCTGGGGCAAGAAGGG - Intergenic
1002883167 6:1270870-1270892 CAGAATTCCTTGGGGAAGGATGG + Intergenic
1003193520 6:3894835-3894857 CAGAAGCTCTGCAGGAATAATGG - Intergenic
1003241750 6:4351219-4351241 CAGGAGCTGCTGGGGAAGGAGGG - Intergenic
1004843436 6:19613067-19613089 CGGGAGCACTTGGAGAAGAAGGG + Intergenic
1005671183 6:28107848-28107870 CAGGAGCTCCTCGGGCAGAATGG - Intergenic
1005869807 6:29966339-29966361 CAGGAGGTCTTGGGGAGGCAAGG - Intergenic
1006002729 6:30978282-30978304 AAGAAAATCTTGGGGAAGAAGGG + Intergenic
1006257899 6:32845625-32845647 CAGCAGCTCATGGAGAAAAAGGG - Exonic
1006433790 6:34015344-34015366 AATATGCTCTTGGGGAAGCAGGG - Intergenic
1007816516 6:44529057-44529079 CAGAAGCTCTTGGTCAAGGTGGG - Intergenic
1008532367 6:52475212-52475234 CAAAAGTTCTTGAGGAAGAAAGG + Intronic
1008815407 6:55558777-55558799 GAGCAGCTCTTGGGGTAGCATGG - Intronic
1009272726 6:61635291-61635313 CAGAATGACTTGGGCAAGAATGG + Intergenic
1009851513 6:69205635-69205657 CAGAAGCTATTGTGCAAGAGAGG + Intronic
1012425491 6:99109627-99109649 CAAAAGATCTTGGGTAAGCATGG + Intergenic
1013012308 6:106131905-106131927 CAGAAGCACCTGGTGAGGAAGGG - Intergenic
1013192628 6:107816549-107816571 AAGAAGCTACTGGAGAAGAAAGG + Intronic
1013667359 6:112362371-112362393 CGGAAGCACCTGGAGAAGAAGGG - Intergenic
1014009272 6:116458247-116458269 CGGGAGCACCTGGGGAAGAAGGG - Intergenic
1015304952 6:131697087-131697109 CAGTAGCTCTAGGGCAAGGAAGG + Intronic
1015750368 6:136552641-136552663 CAGAAACTCTAGGGGAATGATGG - Intergenic
1018628917 6:165805502-165805524 CAGGGGCTCTTGGTGGAGAAAGG - Intronic
1019618643 7:1978731-1978753 CAGAGCCTCTAGGTGAAGAATGG + Intronic
1023041888 7:36179811-36179833 CATGAGCTCTTTGGGATGAAGGG + Intronic
1023269003 7:38439133-38439155 CAGAAGGTTATGGGGAAGCAAGG - Intronic
1024439384 7:49398398-49398420 CACAGGCTCTTGGGAATGAATGG - Intergenic
1024947387 7:54823791-54823813 CACAAGCTCATGCGGAACAAAGG - Intergenic
1025946544 7:66109134-66109156 CACAGGCTCTAGAGGAAGAAAGG - Intronic
1026000038 7:66553722-66553744 GAGCAGCTCTGGGGGAATAAGGG - Intergenic
1026019625 7:66697237-66697259 TAGAGGCTCTTGGGGCAGAGAGG - Intronic
1026506987 7:70993334-70993356 CAGAGGCTTTGGAGGAAGAATGG - Intergenic
1026793572 7:73350956-73350978 CTTAATCTCTTTGGGAAGAAGGG - Intronic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1027906855 7:84196080-84196102 CAGAATCATTTGGGGAATAAAGG - Intronic
1031286321 7:119873269-119873291 CAAAAACTTTTGGGGCAGAATGG - Intergenic
1032027952 7:128458167-128458189 GAGGAGCTCTTGTGGAAGAGAGG - Exonic
1035634777 8:1136371-1136393 CAGATGCTCGTGGGAGAGAAGGG + Intergenic
1036047834 8:5163715-5163737 CAGAGGCTCACGTGGAAGAATGG - Intergenic
1036053858 8:5228786-5228808 CAGGAGGTATTGGGGAGGAAGGG + Intergenic
1037060346 8:14501087-14501109 TAGAAGCTCTTGGGGAGAATAGG + Intronic
1037582339 8:20253107-20253129 CAGAAGCTGTTGGAGAGGGAGGG - Exonic
1038030224 8:23632010-23632032 CAGAAGCTCAGGGAGAAGCATGG + Intergenic
1038976177 8:32698678-32698700 CACCAGTGCTTGGGGAAGAATGG + Intronic
1042187725 8:66153875-66153897 CAGAAGCGCTAAGGGCAGAATGG - Intronic
1042849030 8:73197576-73197598 CAGAAGCTTTTGGTGAAGGGAGG - Intergenic
1045952414 8:107866360-107866382 CAGGGGCCCTTGGGGAAGGAAGG - Intergenic
1046159064 8:110335141-110335163 CAGAAGCTCGGAGGGAAGGAAGG - Intergenic
1046603756 8:116347798-116347820 CATAACCTCTTTGGAAAGAATGG - Intergenic
1047022849 8:120794850-120794872 AAGAAGCTCTTGGGAAGGTATGG - Intronic
1047126994 8:121973658-121973680 CAGAAGCTCGGAGGGAAGCATGG + Intergenic
1047283176 8:123463713-123463735 CAGCAGCTAAGGGGGAAGAAAGG + Intronic
1047546373 8:125821650-125821672 CAGAAGATGAAGGGGAAGAAAGG + Intergenic
1047635732 8:126759976-126759998 AAGAACCTCTTGGTGAAGAGTGG - Intergenic
1050547960 9:6724973-6724995 CAGAGGCTCTGGGGGAGGATCGG + Intronic
1050873197 9:10601910-10601932 CAGAAGACCTTAGGGAAGAAAGG + Intronic
1051655656 9:19379490-19379512 CTGACGCTCTGGGTGAAGAATGG - Exonic
1052613024 9:30800394-30800416 CAGGAGCACCTGGAGAAGAAGGG - Intergenic
1052786125 9:32830380-32830402 CACAGGCTCTGGGGGAAGGAAGG - Intergenic
1052826717 9:33181723-33181745 CAGAAGTCCTGGGAGAAGAAGGG - Intergenic
1053071731 9:35105975-35105997 CTGAACCCCTTGGGGAGGAAGGG - Exonic
1054748579 9:68881136-68881158 TTCAAGCTCTTGGGGAAGGATGG - Intronic
1054921397 9:70546333-70546355 CAGAAACTCTAGGGGTAGGAAGG + Intronic
1055231906 9:74076647-74076669 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
1055281639 9:74681154-74681176 CAGAAGCACTTGGAGATGGAGGG - Intronic
1056781524 9:89554630-89554652 GAGAAGCTCCTGGGGAAGGGAGG - Intergenic
1056844005 9:90021897-90021919 CAGATGCTCATGGTGAAGACAGG - Intergenic
1057445416 9:95111197-95111219 CAAATGACCTTGGGGAAGAAGGG + Intronic
1057943027 9:99301459-99301481 CACATGCCCTTAGGGAAGAAGGG + Intergenic
1059793844 9:117669266-117669288 CTGAAGCACTTAGGGATGAAAGG - Intergenic
1060307144 9:122424094-122424116 CAGAACCTCTTGAGGAAGCTAGG + Intergenic
1060370605 9:123066672-123066694 CTGAAGCTTTGGGGGTAGAAGGG - Intronic
1060562323 9:124556389-124556411 CAGAAGCTCTAGGGGAGAATCGG - Intronic
1060690124 9:125650364-125650386 GTGAAGCTCTGGGGGAAGACCGG - Intronic
1060739628 9:126089850-126089872 AAGAAGCACTTTGGGAAGCAGGG + Intergenic
1061160100 9:128888803-128888825 AAGAGACTCCTGGGGAAGAATGG - Intronic
1061277652 9:129578770-129578792 CAGCGGCTCTGGGGGAAGAGGGG - Intergenic
1061410358 9:130417703-130417725 CAGAACCTCTGGAGGAAGCAGGG + Intronic
1062027937 9:134349168-134349190 CAGAGGGTCTTGCAGAAGAAGGG + Intronic
1187005970 X:15232592-15232614 CATAAGCTGTTGGGAAGGAAGGG + Intergenic
1187415616 X:19090920-19090942 CAGGAGCTCTGGGTGAAGACAGG + Intronic
1189146369 X:38659258-38659280 GAGAGGCTCCTGGGTAAGAAAGG - Intronic
1189928615 X:45983698-45983720 CAGGAGCACCTGGAGAAGAAGGG + Intergenic
1190289250 X:48981426-48981448 CAGAGGATCCTGGAGAAGAAGGG - Exonic
1190913641 X:54794052-54794074 CAGGAGCACTGGGGGAAGATAGG + Intronic
1191266794 X:58403650-58403672 CTGAAGCCATTGGGGGAGAAAGG + Intergenic
1192240975 X:69328097-69328119 CAGAAGCTGAAGGGGAAGTAAGG - Intergenic
1192678308 X:73223622-73223644 GAGCAGCTCTGGGGGAATAAGGG + Intergenic
1192849090 X:74935141-74935163 CAAAAGCTTTTGGTGAAGAAGGG + Intergenic
1193966461 X:87992942-87992964 CAATAGCTTTTGGGGAACAAGGG + Intergenic
1194036636 X:88882989-88883011 AAGAAGCTCTATGGAAAGAAAGG + Intergenic
1196104051 X:111877342-111877364 TAGGAGCTCATGAGGAAGAATGG + Intronic
1196580048 X:117368147-117368169 AAGAAGCTTATAGGGAAGAATGG + Intergenic
1199614468 X:149646010-149646032 CAGAAGCTGGGAGGGAAGAAAGG - Intergenic
1199910880 X:152285472-152285494 CAGAAGCTCTTGGGTTAGGTGGG - Intronic
1200630129 Y:5573477-5573499 CGGGAGCACTTGGAGAAGAAGGG + Intronic
1201929021 Y:19320765-19320787 CAGAAACTCATGAGGAAGAGGGG + Intergenic