ID: 1137685457

View in Genome Browser
Species Human (GRCh38)
Location 16:50383638-50383660
Sequence CCAGGCAAAACAGCCTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137685457_1137685462 -4 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685462 16:50383657-50383679 CTGGAAGGGAAGAAAGCTCCTGG No data
1137685457_1137685467 26 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685467 16:50383687-50383709 AATCTCAAGACCAGGCATATGGG No data
1137685457_1137685468 29 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685468 16:50383690-50383712 CTCAAGACCAGGCATATGGGTGG No data
1137685457_1137685469 30 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685469 16:50383691-50383713 TCAAGACCAGGCATATGGGTGGG No data
1137685457_1137685465 18 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685465 16:50383679-50383701 GGAACAGAAATCTCAAGACCAGG No data
1137685457_1137685463 -3 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685463 16:50383658-50383680 TGGAAGGGAAGAAAGCTCCTGGG No data
1137685457_1137685466 25 Left 1137685457 16:50383638-50383660 CCAAGGAAGGCTGTTTTGCCTGG No data
Right 1137685466 16:50383686-50383708 AAATCTCAAGACCAGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137685457 Original CRISPR CCAGGCAAAACAGCCTTCCT TGG (reversed) Intergenic
No off target data available for this crispr