ID: 1137687032

View in Genome Browser
Species Human (GRCh38)
Location 16:50393397-50393419
Sequence CTCTGGGGCTGGGGGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137687032_1137687044 15 Left 1137687032 16:50393397-50393419 CCCTCTTACCCCCAGCCCCAGAG No data
Right 1137687044 16:50393435-50393457 ATGCTGATGGCGAGTGCTGTGGG No data
1137687032_1137687042 2 Left 1137687032 16:50393397-50393419 CCCTCTTACCCCCAGCCCCAGAG No data
Right 1137687042 16:50393422-50393444 GAGAGAGTTACATATGCTGATGG No data
1137687032_1137687045 18 Left 1137687032 16:50393397-50393419 CCCTCTTACCCCCAGCCCCAGAG No data
Right 1137687045 16:50393438-50393460 CTGATGGCGAGTGCTGTGGGAGG No data
1137687032_1137687043 14 Left 1137687032 16:50393397-50393419 CCCTCTTACCCCCAGCCCCAGAG No data
Right 1137687043 16:50393434-50393456 TATGCTGATGGCGAGTGCTGTGG No data
1137687032_1137687046 19 Left 1137687032 16:50393397-50393419 CCCTCTTACCCCCAGCCCCAGAG No data
Right 1137687046 16:50393439-50393461 TGATGGCGAGTGCTGTGGGAGGG No data
1137687032_1137687047 28 Left 1137687032 16:50393397-50393419 CCCTCTTACCCCCAGCCCCAGAG No data
Right 1137687047 16:50393448-50393470 GTGCTGTGGGAGGGCACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137687032 Original CRISPR CTCTGGGGCTGGGGGTAAGA GGG (reversed) Intergenic
No off target data available for this crispr