ID: 1137694443

View in Genome Browser
Species Human (GRCh38)
Location 16:50452088-50452110
Sequence GGACCCGCATGGCCAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137694443_1137694453 20 Left 1137694443 16:50452088-50452110 CCTGGGGTTGGCCATGCGGGTCC No data
Right 1137694453 16:50452131-50452153 CCCTTGGTCTCCCTCATCAGGGG No data
1137694443_1137694451 19 Left 1137694443 16:50452088-50452110 CCTGGGGTTGGCCATGCGGGTCC No data
Right 1137694451 16:50452130-50452152 ACCCTTGGTCTCCCTCATCAGGG No data
1137694443_1137694450 18 Left 1137694443 16:50452088-50452110 CCTGGGGTTGGCCATGCGGGTCC No data
Right 1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG No data
1137694443_1137694445 -9 Left 1137694443 16:50452088-50452110 CCTGGGGTTGGCCATGCGGGTCC No data
Right 1137694445 16:50452102-50452124 TGCGGGTCCATCTCAGAAGTTGG No data
1137694443_1137694447 4 Left 1137694443 16:50452088-50452110 CCTGGGGTTGGCCATGCGGGTCC No data
Right 1137694447 16:50452115-50452137 CAGAAGTTGGCACCCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137694443 Original CRISPR GGACCCGCATGGCCAACCCC AGG (reversed) Intergenic