ID: 1137694444

View in Genome Browser
Species Human (GRCh38)
Location 16:50452099-50452121
Sequence ACTTCTGAGATGGACCCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137694444_1137694453 9 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694453 16:50452131-50452153 CCCTTGGTCTCCCTCATCAGGGG No data
1137694444_1137694457 29 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694457 16:50452151-50452173 GGGTCCCAACAGCTAGCTCAAGG No data
1137694444_1137694458 30 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694458 16:50452152-50452174 GGTCCCAACAGCTAGCTCAAGGG No data
1137694444_1137694450 7 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG No data
1137694444_1137694451 8 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694451 16:50452130-50452152 ACCCTTGGTCTCCCTCATCAGGG No data
1137694444_1137694447 -7 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694447 16:50452115-50452137 CAGAAGTTGGCACCCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137694444 Original CRISPR ACTTCTGAGATGGACCCGCA TGG (reversed) Intergenic