ID: 1137694446

View in Genome Browser
Species Human (GRCh38)
Location 16:50452109-50452131
Sequence GTGGGTGCCAACTTCTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137694446_1137694462 29 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694462 16:50452161-50452183 AGCTAGCTCAAGGGCCCTGGAGG No data
1137694446_1137694450 -3 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG No data
1137694446_1137694451 -2 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694451 16:50452130-50452152 ACCCTTGGTCTCCCTCATCAGGG No data
1137694446_1137694463 30 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694463 16:50452162-50452184 GCTAGCTCAAGGGCCCTGGAGGG No data
1137694446_1137694461 26 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694461 16:50452158-50452180 AACAGCTAGCTCAAGGGCCCTGG No data
1137694446_1137694453 -1 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694453 16:50452131-50452153 CCCTTGGTCTCCCTCATCAGGGG No data
1137694446_1137694458 20 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694458 16:50452152-50452174 GGTCCCAACAGCTAGCTCAAGGG No data
1137694446_1137694457 19 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694457 16:50452151-50452173 GGGTCCCAACAGCTAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137694446 Original CRISPR GTGGGTGCCAACTTCTGAGA TGG (reversed) Intergenic