ID: 1137694450

View in Genome Browser
Species Human (GRCh38)
Location 16:50452129-50452151
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137694443_1137694450 18 Left 1137694443 16:50452088-50452110 CCTGGGGTTGGCCATGCGGGTCC No data
Right 1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG No data
1137694446_1137694450 -3 Left 1137694446 16:50452109-50452131 CCATCTCAGAAGTTGGCACCCAC No data
Right 1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG No data
1137694444_1137694450 7 Left 1137694444 16:50452099-50452121 CCATGCGGGTCCATCTCAGAAGT No data
Right 1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137694450 Original CRISPR CACCCTTGGTCTCCCTCATC AGG Intergenic