ID: 1137699092

View in Genome Browser
Species Human (GRCh38)
Location 16:50483030-50483052
Sequence CACAAAACAAGCCCAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137699092_1137699095 16 Left 1137699092 16:50483030-50483052 CCAGCCCTTGGGCTTGTTTTGTG No data
Right 1137699095 16:50483069-50483091 TCATTTAAGCCACTTTGATTTGG No data
1137699092_1137699096 17 Left 1137699092 16:50483030-50483052 CCAGCCCTTGGGCTTGTTTTGTG No data
Right 1137699096 16:50483070-50483092 CATTTAAGCCACTTTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137699092 Original CRISPR CACAAAACAAGCCCAAGGGC TGG (reversed) Intergenic
No off target data available for this crispr