ID: 1137702310

View in Genome Browser
Species Human (GRCh38)
Location 16:50506162-50506184
Sequence AGGCAGATCTTCAGCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137702310_1137702312 -7 Left 1137702310 16:50506162-50506184 CCTCTGGGGCTGAAGATCTGCCT No data
Right 1137702312 16:50506178-50506200 TCTGCCTGCCGCTGTCCTGGAGG No data
1137702310_1137702314 0 Left 1137702310 16:50506162-50506184 CCTCTGGGGCTGAAGATCTGCCT No data
Right 1137702314 16:50506185-50506207 GCCGCTGTCCTGGAGGTCACAGG No data
1137702310_1137702311 -10 Left 1137702310 16:50506162-50506184 CCTCTGGGGCTGAAGATCTGCCT No data
Right 1137702311 16:50506175-50506197 AGATCTGCCTGCCGCTGTCCTGG No data
1137702310_1137702317 10 Left 1137702310 16:50506162-50506184 CCTCTGGGGCTGAAGATCTGCCT No data
Right 1137702317 16:50506195-50506217 TGGAGGTCACAGGTTCCAGAAGG No data
1137702310_1137702318 11 Left 1137702310 16:50506162-50506184 CCTCTGGGGCTGAAGATCTGCCT No data
Right 1137702318 16:50506196-50506218 GGAGGTCACAGGTTCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137702310 Original CRISPR AGGCAGATCTTCAGCCCCAG AGG (reversed) Intergenic
No off target data available for this crispr