ID: 1137702684

View in Genome Browser
Species Human (GRCh38)
Location 16:50508179-50508201
Sequence AAGTCTCACCCAGGATCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137702680_1137702684 -7 Left 1137702680 16:50508163-50508185 CCTGTGAGCTCCCATGAAGTCTC No data
Right 1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG No data
1137702679_1137702684 -2 Left 1137702679 16:50508158-50508180 CCTCACCTGTGAGCTCCCATGAA No data
Right 1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG No data
1137702678_1137702684 -1 Left 1137702678 16:50508157-50508179 CCCTCACCTGTGAGCTCCCATGA No data
Right 1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137702684 Original CRISPR AAGTCTCACCCAGGATCACA CGG Intergenic
No off target data available for this crispr