ID: 1137705545

View in Genome Browser
Species Human (GRCh38)
Location 16:50533359-50533381
Sequence TTGTGACTCGGGGGCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137705538_1137705545 8 Left 1137705538 16:50533328-50533350 CCGGCCAAAACAGTACCTGTTTT No data
Right 1137705545 16:50533359-50533381 TTGTGACTCGGGGGCTTGACTGG No data
1137705540_1137705545 -7 Left 1137705540 16:50533343-50533365 CCTGTTTTATGAGCTCTTGTGAC No data
Right 1137705545 16:50533359-50533381 TTGTGACTCGGGGGCTTGACTGG No data
1137705536_1137705545 14 Left 1137705536 16:50533322-50533344 CCGTGCCCGGCCAAAACAGTACC No data
Right 1137705545 16:50533359-50533381 TTGTGACTCGGGGGCTTGACTGG No data
1137705537_1137705545 9 Left 1137705537 16:50533327-50533349 CCCGGCCAAAACAGTACCTGTTT No data
Right 1137705545 16:50533359-50533381 TTGTGACTCGGGGGCTTGACTGG No data
1137705539_1137705545 4 Left 1137705539 16:50533332-50533354 CCAAAACAGTACCTGTTTTATGA No data
Right 1137705545 16:50533359-50533381 TTGTGACTCGGGGGCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137705545 Original CRISPR TTGTGACTCGGGGGCTTGAC TGG Intergenic
No off target data available for this crispr