ID: 1137705804

View in Genome Browser
Species Human (GRCh38)
Location 16:50535062-50535084
Sequence CTTCCCATCCAGACTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137705798_1137705804 9 Left 1137705798 16:50535030-50535052 CCCGCATCCCTCTTCCTTTGGGC No data
Right 1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG No data
1137705795_1137705804 27 Left 1137705795 16:50535012-50535034 CCTCAAGTAAGATAATGTCCCGC No data
Right 1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG No data
1137705802_1137705804 -5 Left 1137705802 16:50535044-50535066 CCTTTGGGCGACTTCATTCTTCC No data
Right 1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG No data
1137705801_1137705804 1 Left 1137705801 16:50535038-50535060 CCTCTTCCTTTGGGCGACTTCAT No data
Right 1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG No data
1137705799_1137705804 8 Left 1137705799 16:50535031-50535053 CCGCATCCCTCTTCCTTTGGGCG No data
Right 1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG No data
1137705800_1137705804 2 Left 1137705800 16:50535037-50535059 CCCTCTTCCTTTGGGCGACTTCA No data
Right 1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137705804 Original CRISPR CTTCCCATCCAGACTGTGGT TGG Intergenic
No off target data available for this crispr