ID: 1137706525

View in Genome Browser
Species Human (GRCh38)
Location 16:50539442-50539464
Sequence CTGGATTCTAACTCTCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137706525_1137706530 -9 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706530 16:50539456-50539478 AGAATCCAGGGAGAACAGGAGGG No data
1137706525_1137706533 -4 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706533 16:50539461-50539483 CCAGGGAGAACAGGAGGGGCTGG No data
1137706525_1137706534 -1 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706534 16:50539464-50539486 GGGAGAACAGGAGGGGCTGGAGG No data
1137706525_1137706531 -8 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706531 16:50539457-50539479 GAATCCAGGGAGAACAGGAGGGG No data
1137706525_1137706529 -10 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706529 16:50539455-50539477 TAGAATCCAGGGAGAACAGGAGG No data
1137706525_1137706535 0 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706535 16:50539465-50539487 GGAGAACAGGAGGGGCTGGAGGG No data
1137706525_1137706536 1 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706536 16:50539466-50539488 GAGAACAGGAGGGGCTGGAGGGG No data
1137706525_1137706537 2 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706537 16:50539467-50539489 AGAACAGGAGGGGCTGGAGGGGG No data
1137706525_1137706538 3 Left 1137706525 16:50539442-50539464 CCTGCAAGAGAGTTAGAATCCAG No data
Right 1137706538 16:50539468-50539490 GAACAGGAGGGGCTGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137706525 Original CRISPR CTGGATTCTAACTCTCTTGC AGG (reversed) Intergenic
No off target data available for this crispr