ID: 1137708224

View in Genome Browser
Species Human (GRCh38)
Location 16:50549312-50549334
Sequence GGCGAAGGACCACGGCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137708224_1137708234 7 Left 1137708224 16:50549312-50549334 CCCCCGTGCCGTGGTCCTTCGCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1137708234 16:50549342-50549364 GCGCCTCCTTCTTCCCTCCGCGG 0: 1
1: 0
2: 1
3: 9
4: 188
1137708224_1137708241 20 Left 1137708224 16:50549312-50549334 CCCCCGTGCCGTGGTCCTTCGCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1137708241 16:50549355-50549377 CCCTCCGCGGGGGTAACTTTTGG 0: 1
1: 0
2: 0
3: 0
4: 19
1137708224_1137708235 8 Left 1137708224 16:50549312-50549334 CCCCCGTGCCGTGGTCCTTCGCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1137708235 16:50549343-50549365 CGCCTCCTTCTTCCCTCCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 227
1137708224_1137708244 27 Left 1137708224 16:50549312-50549334 CCCCCGTGCCGTGGTCCTTCGCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1137708244 16:50549362-50549384 CGGGGGTAACTTTTGGCACCTGG 0: 1
1: 0
2: 0
3: 2
4: 26
1137708224_1137708236 9 Left 1137708224 16:50549312-50549334 CCCCCGTGCCGTGGTCCTTCGCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1137708236 16:50549344-50549366 GCCTCCTTCTTCCCTCCGCGGGG 0: 1
1: 0
2: 2
3: 13
4: 161
1137708224_1137708238 10 Left 1137708224 16:50549312-50549334 CCCCCGTGCCGTGGTCCTTCGCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1137708238 16:50549345-50549367 CCTCCTTCTTCCCTCCGCGGGGG 0: 1
1: 0
2: 4
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137708224 Original CRISPR GGCGAAGGACCACGGCACGG GGG (reversed) Intronic
900691464 1:3983049-3983071 GGCAAAGCACCACAGCCCGGCGG - Intergenic
916203392 1:162293003-162293025 GGCCAAGAAACACAGCACGGTGG - Intronic
922372978 1:224929813-224929835 GCCGTCGGACCACGGCGCGGCGG + Exonic
1073013193 10:100377638-100377660 GACCCAGGACCACAGCACGGAGG + Intergenic
1076332114 10:129677782-129677804 GGCGAAGGAACAGGTCACCGAGG + Intronic
1076373934 10:129971445-129971467 GGCGAGGGTCGGCGGCACGGCGG - Intergenic
1079955742 11:26862329-26862351 GGTGAAGGAAAACGGCACTGGGG + Intergenic
1083160858 11:60853287-60853309 GGCGCAGAACCACCGCACCGTGG - Exonic
1084446290 11:69205475-69205497 GGAGAAGGACCCCGGCTGGGTGG + Intergenic
1085385004 11:76152561-76152583 GGCGATGGGCCACCGCGCGGAGG + Intergenic
1085722113 11:78921650-78921672 GGTGCAGGACCAAGGCAAGGAGG + Intronic
1086385465 11:86302525-86302547 GGCGAAGCCCTACGGCAGGGAGG + Intronic
1090709916 11:129375300-129375322 GGGGAAGGAGAAAGGCACGGTGG + Intergenic
1091079090 11:132649440-132649462 GGGATAGGACCACGGCATGGTGG + Intronic
1106208338 13:27620218-27620240 CGCGAAGGACCAAGGCTCCGGGG + Intronic
1113378019 13:109782556-109782578 GGCGAAGGACGGGGACACGGGGG + Exonic
1122540737 14:102496451-102496473 GCCCAAGGACCAGGGCAGGGCGG + Intronic
1123063989 14:105606926-105606948 GGCGAAGGCCCAGGCCACTGAGG - Intergenic
1123093228 14:105751336-105751358 GGCGAAGGCCCAGGCCACTGAGG - Intergenic
1127253965 15:57271971-57271993 TGCCAAGGACCACGGGATGGAGG - Intronic
1127335474 15:57979541-57979563 TGCGAAGGACCAAGGCAAGGGGG + Intronic
1129773038 15:78214757-78214779 GGCCAAGGAGCAGGGCACAGAGG + Intronic
1132799068 16:1742601-1742623 GGCCAAGGAACAAGGCACAGGGG + Intronic
1137708224 16:50549312-50549334 GGCGAAGGACCACGGCACGGGGG - Intronic
1141595538 16:85094871-85094893 GGGGAAGGAGCAGGGCACAGGGG + Intergenic
1147583545 17:41639665-41639687 GGAGGAGGACCAGGGCAGGGAGG + Intergenic
1150143597 17:62750283-62750305 GGGGAAGTAGCACAGCACGGCGG + Intronic
1152210014 17:78998114-78998136 GGCCAAGGACCCAGGGACGGAGG - Intronic
1152408368 17:80110060-80110082 GGCGAGGGTCCAGGGGACGGGGG + Intergenic
1153951068 18:10058203-10058225 GGCTCAGGACCACTGCAAGGGGG + Intergenic
1156461905 18:37326024-37326046 GGCCAAGGACCAGGGGAGGGAGG - Intronic
1163223404 19:15937657-15937679 CGTGAAGGAGCACGGCCCGGTGG - Intergenic
1163610545 19:18299142-18299164 GGCGAGGGAGCAGGGCACAGTGG - Intergenic
1164709496 19:30345219-30345241 GGGGGAGGACCACGCCCCGGGGG + Intronic
1165728721 19:38130569-38130591 CGTGAAGTACGACGGCACGGTGG + Exonic
1165730796 19:38143380-38143402 GGAGGAGGACCACTGCAAGGAGG - Intronic
927881546 2:26693096-26693118 GGCGAAGCGCCACTGCACGCCGG - Exonic
928098928 2:28423556-28423578 GGCTCAGGACCAGGGCAGGGTGG - Intergenic
932775783 2:74527554-74527576 GGAGAAGGACCAGGGGAGGGAGG + Exonic
934949010 2:98563610-98563632 GGCAGAAGACCACGTCACGGCGG - Exonic
943247367 2:185473130-185473152 GATGAAGGACCACGGGAGGGAGG + Intergenic
946249191 2:218402614-218402636 GGCGAGGGAGCACAGCACGGGGG - Intronic
948287297 2:236795763-236795785 GGCTAAGGATCAGGGCACTGTGG + Intergenic
948568441 2:238901262-238901284 GGCAAAGGAGGCCGGCACGGTGG - Intronic
1169158405 20:3354383-3354405 GGCTAAGGGCCAAGGCACAGTGG - Intronic
1172837904 20:37884869-37884891 GGTGAAGGACCCCGGCAGAGGGG - Intergenic
1175720962 20:61287063-61287085 GGCCAAGGAGCAGGGCACGGAGG - Intronic
1179995232 21:44971121-44971143 GGCGGAGGTCCACAGCATGGGGG - Intronic
1180866819 22:19124473-19124495 GGGGAAGGGCCACGGCAGGTGGG + Intergenic
1181683550 22:24513326-24513348 GGCGAAGAACCATGACATGGTGG + Exonic
1182397368 22:30046096-30046118 TGCGAAGGACCAAGGCAAAGGGG + Intergenic
1184193338 22:42909531-42909553 GGCGGACGACCACAGCACTGCGG + Intronic
1184402582 22:44282419-44282441 GGTCAAGGACCACCGCAGGGGGG - Intronic
952205937 3:31181575-31181597 TGTGAAGGACCAAGGCAAGGGGG + Intergenic
962007473 3:131362420-131362442 GGCCAAGGACCACGGGCTGGAGG + Intergenic
968093907 3:195914765-195914787 GGCTAAGGCCCACGGAAGGGAGG + Intergenic
968733891 4:2285339-2285361 GACGAAGCACCGCGGCAAGGTGG - Intronic
968910562 4:3475262-3475284 GGCGCAGGGCCATGGCACAGAGG + Intronic
969574754 4:8030349-8030371 GGCGTGGCACCATGGCACGGGGG + Intronic
985063305 4:186098892-186098914 GGCGGAGGACCAGACCACGGAGG - Intergenic
1013512760 6:110859298-110859320 TGCGAAGGACCAAGGCAAGGGGG - Intronic
1013803491 6:113971583-113971605 GGCGATGGGCCACAGCCCGGCGG - Intronic
1014175296 6:118325464-118325486 GGCGCAGGAACACCGCAAGGTGG - Intergenic
1018727786 6:166627114-166627136 GGCCAGGGAGCCCGGCACGGCGG + Intronic
1019919740 7:4155917-4155939 AGGGAAGGAACAGGGCACGGGGG + Intronic
1035364919 7:158342913-158342935 AGCGAAGGAGAACGGCAGGGTGG + Intronic
1036044317 8:5122764-5122786 AACGAAGCACCACGGCACGTGGG - Intergenic
1036044331 8:5122860-5122882 AACGAAGCACCACGGCACGCGGG - Intergenic
1049195914 8:141315500-141315522 GGCTGAGGACCACGGCCTGGAGG - Intergenic
1049681733 8:143921783-143921805 GGCGCAGGGCCACACCACGGTGG - Exonic
1061921677 9:133785874-133785896 GCCGTAGGACCACTGCAGGGGGG + Exonic
1062389288 9:136327639-136327661 GGCGGACGGCCACGGCGCGGGGG + Exonic
1062443603 9:136584266-136584288 GGTGAAGGACCAAGGCCCGATGG + Intergenic
1203771959 EBV:54040-54062 GGCGAAGGCCCACGAGATGGCGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1189381678 X:40506782-40506804 GGCCAAGGACCACGCATCGGGGG + Intergenic