ID: 1137709427

View in Genome Browser
Species Human (GRCh38)
Location 16:50555957-50555979
Sequence CCTTCCTCAGGGAGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 414}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137709427_1137709435 22 Left 1137709427 16:50555957-50555979 CCCCACCCTCTCCCTGAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 414
Right 1137709435 16:50556002-50556024 CAAAATATCTGCCATTCCATCGG 0: 1
1: 0
2: 0
3: 26
4: 338
1137709427_1137709436 25 Left 1137709427 16:50555957-50555979 CCCCACCCTCTCCCTGAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 414
Right 1137709436 16:50556005-50556027 AATATCTGCCATTCCATCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 113
1137709427_1137709437 26 Left 1137709427 16:50555957-50555979 CCCCACCCTCTCCCTGAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 414
Right 1137709437 16:50556006-50556028 ATATCTGCCATTCCATCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137709427 Original CRISPR CCTTCCTCAGGGAGAGGGTG GGG (reversed) Intronic
900206667 1:1434634-1434656 GCATCCTCCAGGAGAGGGTGGGG + Intergenic
901157868 1:7152610-7152632 GCCTCCTCAGGGAGAAGGGGAGG + Intronic
901302871 1:8212261-8212283 CCTAGCACACGGAGAGGGTGGGG - Intergenic
902863625 1:19262971-19262993 CCTTCCTCACTGAGCAGGTGAGG - Intergenic
903342345 1:22662295-22662317 CCTGCTTCAGGGAGGAGGTGTGG - Intergenic
903572864 1:24319243-24319265 CCTTCCTTGGTGAGGGGGTGGGG - Intergenic
903684174 1:25119077-25119099 CCTTCCTGAGGGAGAGGGAATGG + Intergenic
903734866 1:25523691-25523713 CCTTGCTCAGGAAGAAGGGGTGG - Intergenic
904046477 1:27612256-27612278 CCTTCCTTTGGGAGCGGGGGTGG - Exonic
904306436 1:29593125-29593147 CCTTCCTCAGGGAAAAGAGGTGG + Intergenic
904330602 1:29755728-29755750 CCTCCCTCAGGCTGAGGGAGGGG + Intergenic
905282013 1:36855298-36855320 CATTCCGCAGGGAGAGGCTGTGG - Intronic
905442765 1:38005525-38005547 ACTTCCTCGGGGAGGGGTTGGGG - Intronic
905451902 1:38062388-38062410 TTTTCCTCCGGAAGAGGGTGAGG - Intergenic
905455250 1:38084043-38084065 CCTTCCACAGTGGGGGGGTGGGG - Intergenic
905735691 1:40324281-40324303 CATCCCTCAGGGACAGGGGGTGG + Intergenic
906054384 1:42903651-42903673 CCTTCCTCTGGTAAAGGCTGCGG + Intergenic
906820313 1:48922474-48922496 CCTTTCTCAGGGAGAAGTAGAGG - Intronic
906955372 1:50369712-50369734 CCGTGCTGAGGTAGAGGGTGAGG - Intergenic
908113628 1:60920636-60920658 CCTTCCCCAGGCAGAGGAAGAGG - Intronic
908420445 1:63953740-63953762 CCTTCATTAGGGCAAGGGTGAGG + Intronic
910388684 1:86713734-86713756 CATTCTTCAGGGAGAGGAAGAGG - Intronic
912491658 1:110065888-110065910 CTTGCCAGAGGGAGAGGGTGTGG - Intronic
912624954 1:111199147-111199169 CCTTCACCAGGTAGAGGGTTGGG - Intronic
912801530 1:112722720-112722742 GCTTCCTCAGGGTGAGGGCAAGG - Intronic
913129767 1:115828802-115828824 ACCTCCTCTGGGAGAAGGTGGGG - Intergenic
913537564 1:119787866-119787888 ACTTCCTCTGGAACAGGGTGTGG + Intergenic
915727475 1:158028072-158028094 CCTACCTCAGGGACATGGTAGGG - Intronic
915948892 1:160174569-160174591 ACTTCCTCAGGGAGCCGTTGTGG + Exonic
916853494 1:168727074-168727096 TCTTCCTCCTGGAGAGGGTGGGG - Intronic
918070120 1:181128551-181128573 GCTTCCTCAGGAAGAAGGAGAGG - Intergenic
919295463 1:195693862-195693884 CCTTCCAGTGGGACAGGGTGTGG - Intergenic
919803377 1:201366655-201366677 TCTTCCTAAGGGAGTGAGTGAGG - Intronic
919991215 1:202709726-202709748 CCTGGGTCAGGGAGAGGTTGGGG - Intronic
920260116 1:204683618-204683640 ACTGCATTAGGGAGAGGGTGTGG + Intronic
922876821 1:228946234-228946256 CTTTCTCCAGAGAGAGGGTGAGG - Intergenic
922887451 1:229031068-229031090 GCTTCCTCAGGCAGAGGAAGGGG - Intergenic
923215623 1:231845578-231845600 CCTGCTTCAGGGAGAGGGAATGG + Intronic
923229042 1:231966566-231966588 CCATCCTCAGGGGGAGGGCTTGG - Intronic
924210921 1:241766583-241766605 CCTATCTAATGGAGAGGGTGAGG + Intronic
1063495353 10:6502419-6502441 GGTTCCTCAGGGTGTGGGTGGGG + Intronic
1063862678 10:10328619-10328641 GCTTCCTCAGAGAGGGGTTGAGG + Intergenic
1064022970 10:11823868-11823890 GCGGCCTCGGGGAGAGGGTGCGG + Intronic
1064172162 10:13043212-13043234 CCTGGGTCAGGGAGAGGGAGAGG - Intronic
1064288949 10:14015557-14015579 CCTTGCTGTGGGAGAGGGTGTGG + Intronic
1066658896 10:37720801-37720823 CCTTCCACAGGGAGAAAGGGGGG - Intergenic
1067933645 10:50589047-50589069 TCTTGATCAGGGAGAAGGTGAGG + Intronic
1069739081 10:70675953-70675975 CCTTCCTCACTGGCAGGGTGGGG + Intronic
1069924040 10:71835972-71835994 TCTTCCTCCAGGAGAGGGTAAGG + Intronic
1069932063 10:71889584-71889606 CCTCTCTCAGGAAGAAGGTGAGG - Intergenic
1070404885 10:76085844-76085866 CCTTCATGAGGAAGAGGATGGGG - Intronic
1070739678 10:78894541-78894563 GCTTCCCCAGGCAGAGGATGTGG + Intergenic
1071371491 10:84956027-84956049 CGTTCCTGAGGCAGAGTGTGAGG + Intergenic
1072721026 10:97781251-97781273 GCCTCCTTAAGGAGAGGGTGAGG + Intergenic
1072965106 10:99965182-99965204 CCTACCTCAGGGTGATTGTGAGG - Intronic
1073086089 10:100890052-100890074 CCTTCCTCGGGGTGAGAATGGGG - Intergenic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073630234 10:105141049-105141071 CCTACCTCAGGGAGATGGCTTGG - Intronic
1074156267 10:110802629-110802651 CCTTCCTGAGGGAGATAGTTTGG + Intronic
1074373010 10:112915567-112915589 GGTTCCTAAGGGTGAGGGTGGGG + Intergenic
1074391814 10:113064242-113064264 GCCTCCTCTGGGAGAGGGAGGGG + Intronic
1075088403 10:119429241-119429263 CCTTCCTCAGAGTGCGGCTGTGG + Intronic
1075679452 10:124322018-124322040 CCATCTGCAGGGACAGGGTGTGG - Intergenic
1076922657 10:133462871-133462893 CCAGACTCAGTGAGAGGGTGTGG + Intergenic
1076923187 10:133466127-133466149 CCTCCATGAGGGAGAGGGTGTGG + Intergenic
1076943798 10:133629202-133629224 CCTTCCAGAGGGACAGAGTGAGG - Intergenic
1077156195 11:1092826-1092848 CTTTCCTGGGGGTGAGGGTGAGG - Intergenic
1077321637 11:1945542-1945564 CCTTCCTCAGGGCGAGGCAGGGG - Intergenic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1077504088 11:2922233-2922255 CCTTGCCCAGTGAGAGGGTCAGG - Intronic
1078488861 11:11750757-11750779 CATTCCTCTGGCAGAGGGAGAGG + Intergenic
1078740836 11:14064854-14064876 CCTTCCTTAGGGTGAGGTAGAGG + Intronic
1078891240 11:15560692-15560714 GCATCCTCAGGCAGAGGCTGTGG - Intergenic
1079128476 11:17734711-17734733 CCTTCCTCCGGGGGCGAGTGCGG + Intergenic
1080255200 11:30282440-30282462 GCTCCCTCAGGCAGAGGCTGTGG - Intergenic
1081460005 11:43263798-43263820 TCTTCCACAGGGAGAAGCTGAGG - Intergenic
1081618234 11:44603184-44603206 CCTTCCTCAGGGTGAGTGCGGGG - Intronic
1081706418 11:45184426-45184448 CTTTCCCCAGGTAGAGCGTGTGG + Intronic
1082024926 11:47565182-47565204 CCTTCCTCTGGTCGAGGGTTGGG + Intronic
1082309842 11:50633045-50633067 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1083427516 11:62596199-62596221 CCTTCCTCAGTGATTGGGGGTGG - Intronic
1083428027 11:62599288-62599310 CCAACCTCAGGGAGAAGGGGGGG + Intronic
1083596464 11:63920274-63920296 CCTTCCTCAAGGTGAGGCCGAGG + Intergenic
1083619819 11:64043340-64043362 CCTTCCTGCCAGAGAGGGTGGGG - Intronic
1083655015 11:64225398-64225420 CCTTCCTCAGGGAGCGGTGGAGG + Intronic
1083719457 11:64597259-64597281 GCTGCCTGAGGGAGAGAGTGTGG - Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1084949014 11:72654505-72654527 CCTCCCAGAGGGAGAGTGTGGGG + Intronic
1085509649 11:77081812-77081834 CCTTCCCCAGGGTGAAGGGGTGG + Intronic
1086038450 11:82445148-82445170 CCTTACTCAGGGAGAGCCAGAGG - Intergenic
1087680614 11:101215010-101215032 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1087812227 11:102620885-102620907 GAATCCTCAGGGAGGGGGTGAGG + Intronic
1088900862 11:114115961-114115983 CCTGCTTCATGGACAGGGTGGGG - Intronic
1089535458 11:119158316-119158338 CCATCCTCAGGGACACGGTGAGG + Exonic
1090357672 11:126150731-126150753 CCTGTCCCAGTGAGAGGGTGGGG + Intergenic
1090808919 11:130220078-130220100 CCTTCCAGAGGCAGAGGGTACGG + Intergenic
1202804655 11_KI270721v1_random:855-877 CCTTCCTCAGGGCGAGGCAGGGG - Intergenic
1092782090 12:11996648-11996670 CCAACCTCAGGGAGGGGGAGTGG - Intergenic
1094049722 12:26205665-26205687 CCTACCTCAGGAAGATAGTGGGG + Intronic
1094865633 12:34527394-34527416 CAATCCTCAGGGACAGGCTGTGG + Intergenic
1095794184 12:46199112-46199134 GCTTGCTCAGGGAGGGGGTGGGG + Intronic
1096121843 12:49093709-49093731 CCCTCCTCAGGTAGATGGTCTGG + Intronic
1096512956 12:52141972-52141994 CCTCACTCAGCCAGAGGGTGTGG + Intergenic
1096732545 12:53626121-53626143 CCTGTCTGAGGAAGAGGGTGGGG - Intronic
1096786272 12:54018843-54018865 CGCGCCTCTGGGAGAGGGTGGGG - Intronic
1097439314 12:59590042-59590064 CCTTCCTGCTGGAGAGGATGTGG + Intergenic
1098022365 12:66169670-66169692 CCCTCCTCAGGGAGTCGGGGAGG - Intronic
1098617894 12:72552931-72552953 CCTTGCTCATTGAGAAGGTGAGG + Intronic
1099555447 12:84103809-84103831 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1101501772 12:105310877-105310899 CAATCCTCAGGGACAGGCTGTGG + Intronic
1101931712 12:109020337-109020359 CCTTCCTAGAGGAGAGGGTTGGG - Intronic
1102497568 12:113330091-113330113 CATTCCACAGGGTGAGGGGGAGG - Intronic
1102743700 12:115231141-115231163 CCTTTCTCAGGGACAGTTTGAGG - Intergenic
1103343769 12:120235679-120235701 CCCTCCTGAGGCAGAGGGTGAGG - Intronic
1103604479 12:122077042-122077064 CCTTTGTCAGGAAGAGGGTGGGG + Intergenic
1103779283 12:123388802-123388824 CCTTCCTCCGCGAGTGGCTGAGG + Intronic
1104079190 12:125415395-125415417 CCTTCCTCTGGGAGATGTGGGGG - Intronic
1104811198 12:131621290-131621312 CCTGCCCCGGGGAGAGGCTGAGG - Intergenic
1105731915 13:23226032-23226054 TCTGCCTGAAGGAGAGGGTGTGG - Intronic
1105881757 13:24612171-24612193 CCTTCCACAGCGAGGGGGTTGGG + Intergenic
1106116298 13:26820750-26820772 GCTGGCGCAGGGAGAGGGTGGGG + Intergenic
1106275980 13:28207029-28207051 CCTGCCTCTGTGAGAGGGGGAGG - Intronic
1107031028 13:35853909-35853931 CCACCCTAAGGAAGAGGGTGAGG - Intronic
1107484682 13:40814157-40814179 ACTCCCTCAGGCAGAGGCTGAGG - Intergenic
1107555824 13:41516073-41516095 ACTTCCTCTGGGAGCAGGTGAGG + Intergenic
1107599857 13:42002399-42002421 CCTTCCCTGGGGAGAGGTTGAGG - Intergenic
1107666970 13:42700415-42700437 CCTTCCTCATGCTGGGGGTGGGG - Intergenic
1109171252 13:59099604-59099626 CCTTTCTCAGTGTGAGGGTCAGG - Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1110394376 13:75012501-75012523 CCCTTATCAGGGACAGGGTGGGG + Intergenic
1111937675 13:94573225-94573247 CCTATCTATGGGAGAGGGTGGGG + Intergenic
1112020622 13:95368080-95368102 CCTAGCTCTGGGAGCGGGTGTGG - Intergenic
1113225859 13:108158947-108158969 CCTTCCTTAGGGAGATGACGAGG - Intergenic
1113365194 13:109669272-109669294 CCTTGCTCTGGGGTAGGGTGGGG + Intergenic
1113469841 13:110536483-110536505 CTTTCCTCGGGGAGAGGAAGTGG - Intronic
1113473221 13:110561545-110561567 CCAGCCTCGGGGAGAGGGCGCGG - Exonic
1113633187 13:111901801-111901823 CCTTCCACAGGGAGAGGGCCCGG - Intergenic
1113709342 13:112453527-112453549 GAATCCTCAGTGAGAGGGTGAGG + Intergenic
1113982800 13:114290239-114290261 CCTTCCCCAGGGACAGTCTGTGG - Intronic
1115468146 14:33738616-33738638 CTTTCCTGAGGAAGGGGGTGTGG - Intronic
1115568633 14:34646950-34646972 CCATCCTGAGGCAGTGGGTGTGG + Intergenic
1116560178 14:46368575-46368597 CCTTCCCCAAGGAAGGGGTGAGG - Intergenic
1118074126 14:62280081-62280103 ACTTCCTCAGGGAGAGTAAGAGG + Intergenic
1118305585 14:64652340-64652362 GCTTGCTCAGGGAGTGGGGGTGG + Intergenic
1118816300 14:69316647-69316669 CCTTCCACAGAAAGAGAGTGTGG + Intronic
1118819322 14:69334766-69334788 CCTTCCTCAGGCAGACAGGGAGG - Intronic
1119161682 14:72458125-72458147 CCTTGCTCAGTGTGGGGGTGAGG - Intronic
1119194133 14:72704520-72704542 CCTACCTCAGGCAGGGGGTGGGG - Intronic
1119199995 14:72745078-72745100 GCATCCTCAGGGGGTGGGTGTGG + Intronic
1119390274 14:74286945-74286967 CCTGCCTCAGGGAGAAGGATGGG + Intronic
1121365324 14:93303833-93303855 CCTTCCTCTGGTGGGGGGTGGGG - Intronic
1122034624 14:98938337-98938359 ACTGCCTCAGAGAGAGGCTGGGG - Intergenic
1122115353 14:99524814-99524836 CCTTCCTCAGGGGGAGGCAGGGG + Intronic
1122118997 14:99541938-99541960 CCTTGCTCAGGGGGAGGGGCTGG - Intronic
1122141133 14:99663779-99663801 CCTTACCCAGGGTGAGGGTGAGG - Intronic
1122618887 14:103041832-103041854 GCTTCCTGGGGTAGAGGGTGAGG - Intronic
1122637602 14:103137747-103137769 CTTTACTGAGGAAGAGGGTGGGG + Intergenic
1122862365 14:104588366-104588388 CCTCCCTCGGGGAGGGAGTGAGG - Intronic
1123124561 14:105937297-105937319 CCTTCCTCATGGGGAGGGTGTGG - Intergenic
1124210800 15:27763738-27763760 TGTGCCTCAGGGAGAAGGTGAGG + Intronic
1125714153 15:41809830-41809852 CCTGCCTCACAGAGAAGGTGGGG - Intronic
1127964223 15:63911937-63911959 TCTTCATCAGCGAGCGGGTGAGG + Exonic
1128109365 15:65067180-65067202 CCTTCTACGGGGAGGGGGTGTGG + Intronic
1128539839 15:68518746-68518768 CCTTTCTGATGGAGAGGGGGTGG + Intergenic
1128726942 15:69995076-69995098 TCTTGCTCAGGGCAAGGGTGGGG - Intergenic
1129683852 15:77673608-77673630 CCTCCATCAGTTAGAGGGTGGGG - Intronic
1130231308 15:82099387-82099409 CATCCCTGAGGAAGAGGGTGAGG - Intergenic
1131144361 15:90001734-90001756 CCGTCCCCAGGGAGAGGCGGGGG - Intronic
1131540021 15:93268074-93268096 CGTGGCTCAGGGAGTGGGTGGGG + Intergenic
1132516137 16:366888-366910 CTTTCCTCTGGTAGAGGGTCTGG - Intergenic
1132558427 16:582813-582835 CCGTCTGCAGAGAGAGGGTGGGG - Intronic
1132668750 16:1094263-1094285 CCGTCCCCACCGAGAGGGTGGGG + Intronic
1132674057 16:1114451-1114473 TCTTCCACAGGGAGAGTTTGGGG - Intergenic
1132810454 16:1794370-1794392 CCATCCTCGGGGAGTGTGTGGGG + Intronic
1133196851 16:4177206-4177228 CCTTCCGCAGAGAACGGGTGTGG - Intergenic
1133385311 16:5365047-5365069 GATTCCTCAGGGAGGGAGTGGGG + Intergenic
1136174555 16:28507925-28507947 CCATCTTCAGGGAGAGGATGGGG + Intronic
1136272456 16:29156553-29156575 CCGTCCTCAGGGTGGGGCTGTGG - Intergenic
1136295125 16:29297302-29297324 TCTTCCCCAGGGAGGGGGTTAGG + Intergenic
1137709427 16:50555957-50555979 CCTTCCTCAGGGAGAGGGTGGGG - Intronic
1139640799 16:68290134-68290156 CTTTCCTGAGGAAGTGGGTGGGG + Intronic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1141164293 16:81650239-81650261 CATTCCCCAGGGAGCGGGAGGGG - Intronic
1141641293 16:85343064-85343086 CCTTCCTCCCTGAGAGGCTGAGG - Intergenic
1142767668 17:2074836-2074858 CTTTCCTGATGGAGAGGGAGGGG + Intronic
1142808517 17:2384498-2384520 CTTACCTCGGGGAGAGGGGGAGG - Exonic
1143153128 17:4819237-4819259 CCTCTGGCAGGGAGAGGGTGTGG + Intronic
1143492782 17:7294031-7294053 CCTTCCTGGGAGAGAGGGCGGGG - Intronic
1144614023 17:16751989-16752011 GCTCCCTCAGGCAGAGGCTGTGG + Intronic
1144898688 17:18563682-18563704 GCTCCCTCAGGCAGAGGCTGTGG - Intergenic
1145133687 17:20382041-20382063 GCTCCCTCAGGCAGAGGCTGTGG + Intergenic
1145801608 17:27689781-27689803 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1146834466 17:36099112-36099134 CCCTGCTCAGGGTGAGGGGGTGG + Intergenic
1146916900 17:36683686-36683708 CCTTCCCCAGAGAAACGGTGGGG - Intergenic
1147614923 17:41822084-41822106 CCTTCCTGAGTTACAGGGTGCGG + Intronic
1147705200 17:42421425-42421447 CCTTCAGCAGGGAGAGGAAGGGG + Intronic
1150544208 17:66136508-66136530 CCCTCCCCAGGGAGAAGCTGTGG - Intronic
1150624049 17:66830125-66830147 TCTTCCTCATTGAGAGTGTGCGG - Intergenic
1151528697 17:74689979-74690001 CCAGCCTCAGGGACAGAGTGAGG - Intronic
1152615052 17:81334100-81334122 ACCTCCTCAGGCAGGGGGTGAGG + Intergenic
1152639731 17:81444531-81444553 CCATCCACAGGGAGGGGCTGCGG - Exonic
1153728529 18:7982393-7982415 CCTTCCAGTGGGAGAGGATGTGG - Intronic
1156627369 18:38925178-38925200 TCTACCTCAGGGAGAGTGAGAGG + Intergenic
1156831786 18:41500522-41500544 CCTTCCTCAGGATGTGGGGGTGG + Intergenic
1158259369 18:55590161-55590183 CCTTCCTCAGGGAGACCTGGGGG - Intronic
1159661736 18:71105584-71105606 CCTGCCCCAAGGAGAGGCTGAGG + Intergenic
1160084547 18:75763536-75763558 CCTTCCTCTGGGGGAAGGGGTGG + Intergenic
1160629179 18:80233445-80233467 CCTTCATGAGGGAGAGGAAGTGG - Intronic
1160856018 19:1218323-1218345 ACTTCCACAGGGAGATGGGGAGG + Intronic
1161353083 19:3804420-3804442 CCTACATCAGGGAGAGAGGGAGG + Exonic
1161589064 19:5120585-5120607 CCTTCCCCAGGGGGAGGTTTTGG + Intronic
1161714591 19:5868148-5868170 CCGTCCTGGGGGAGAGGCTGAGG + Intronic
1162104451 19:8361968-8361990 CCCTACTCAGAGAGAGGCTGGGG + Intronic
1162799695 19:13103659-13103681 CCTCCCACAGGGAGAGGCTCTGG + Intergenic
1162943437 19:14028102-14028124 CTTTCTTCAGGCAGAGTGTGGGG + Intergenic
1163004504 19:14389136-14389158 CGTGTCTCAGGGAGAGGGAGAGG + Intronic
1163105322 19:15119900-15119922 ACTGACTCAGGGAGAGGGTCAGG + Intronic
1163105333 19:15119930-15119952 CTCCCCTCAGGGAGAGGGTAGGG + Intronic
1163157854 19:15449208-15449230 CCCTCCCCAGGGAGATGGTGGGG + Intronic
1164378069 19:27706992-27707014 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1164620707 19:29694648-29694670 ACTTCCCCAGGGGGAGGGTGCGG - Intergenic
1165075713 19:33278925-33278947 GCTGCCCCAGGGAGTGGGTGGGG - Intergenic
1166317163 19:41995738-41995760 CCATCCCCAGGGAGAGTCTGGGG - Intronic
1166345657 19:42163620-42163642 CCTCCCTCAGGGAGGGACTGAGG - Intronic
1166350886 19:42197561-42197583 CCTTCCTCAGGGGTGGGGAGTGG - Intergenic
1167130208 19:47580404-47580426 CCAACATCAGGGAAAGGGTGAGG + Intergenic
1168498749 19:56875797-56875819 CCCTTCTCAGGGAGTAGGTGCGG + Intergenic
1168594113 19:57661248-57661270 CCTTCCTTAGGTTGAGGTTGTGG - Intergenic
925259587 2:2517976-2517998 CTTTCTTCTGGGAGAGGTTGGGG + Intergenic
925923496 2:8654004-8654026 TCTTCCTCAGGACGAGGTTGGGG + Intergenic
925959980 2:9004559-9004581 ACTTTCTCAGGAAGAAGGTGGGG - Intergenic
927151225 2:20197394-20197416 CGTTCCTCGGGCTGAGGGTGTGG - Intergenic
927848132 2:26482240-26482262 CCTGCCTCAGGGGGAGGGTGAGG - Intronic
928265427 2:29807397-29807419 CAGCCCTCAGGAAGAGGGTGAGG + Intronic
928454525 2:31407119-31407141 CCTTCCTAAAGGAGAAGGGGAGG + Intronic
929564248 2:42974963-42974985 CCTTTCTCTGGGGGACGGTGAGG + Intergenic
929844231 2:45505143-45505165 CCTTTCTCAGGAAGAGGCTGAGG - Intronic
931320772 2:61172920-61172942 CCTTGCTAAGGGGGTGGGTGTGG + Intergenic
931612627 2:64119620-64119642 ACTTCCTTAGGGAGGAGGTGAGG - Intronic
934522993 2:95031548-95031570 CAGTTCTCAGGGAGAGGCTGGGG + Intronic
934615649 2:95769092-95769114 CCTTGCTTTTGGAGAGGGTGTGG - Intergenic
934645249 2:96055466-96055488 CCTTGCTTTTGGAGAGGGTGTGG + Intergenic
934766534 2:96883088-96883110 CCTTCCCCAGGGGGAGGGCACGG - Intronic
934838654 2:97611555-97611577 CCTTGCTTTTGGAGAGGGTGTGG + Intergenic
935142461 2:100365407-100365429 CAATCCTCAGGGACAGGCTGTGG - Intergenic
935384119 2:102483373-102483395 CCTTCCTCAATGAAAGGGTGAGG - Intronic
935626584 2:105176709-105176731 CCATCCTCAAGGGGAGGGAGAGG + Intergenic
935732576 2:106076446-106076468 CCTTCCCAAGGCAGAGGCTGAGG + Intronic
936729297 2:115361082-115361104 GCTCCCTCAGGCAGAGGCTGAGG + Intronic
938540129 2:132278774-132278796 CCTTCCTCCTGGGAAGGGTGTGG - Intergenic
939458379 2:142467019-142467041 ACTTCTTCAGTGAGAGGCTGTGG - Intergenic
941888055 2:170549967-170549989 CCTTCCTGAGGGAGATTATGCGG - Intronic
942126234 2:172828417-172828439 CCTTCCACAGGGAGAGCCTGAGG - Intronic
943024917 2:182616184-182616206 CCTACCTCAGTGAGATGCTGAGG + Intergenic
945637765 2:212378223-212378245 TCTTCCTCAGAGAGAGAGAGAGG - Intronic
945747851 2:213740694-213740716 ACCTCCTCAGTGAGAGGCTGTGG + Intronic
946087063 2:217184824-217184846 CCTTCCTGTGGGAGAAGATGTGG - Intergenic
946256437 2:218445459-218445481 CCTGCCTCAGGGAGTGGGGAAGG + Intronic
946866224 2:224043380-224043402 CGTTCCACTGGGAGAGAGTGTGG - Intergenic
947672424 2:231946698-231946720 CCAGCCTCAGGAAGAGGCTGAGG - Intergenic
1169384203 20:5134204-5134226 CCTTACCCAGGCAGTGGGTGAGG + Intronic
1170606902 20:17881640-17881662 CCTGAGTCAGGGAGAGGTTGGGG + Intergenic
1170957253 20:20992319-20992341 CCTTCTTCATGAAGTGGGTGGGG + Intergenic
1171209085 20:23303189-23303211 CCTTCTCCAGGGAGTGGGTAGGG + Intergenic
1171770986 20:29323651-29323673 CCACCTTCAGGGAGAGGGTCTGG + Intergenic
1172603005 20:36196443-36196465 GCTTGCACAGGGAGAGGGTTTGG - Intronic
1172902735 20:38346729-38346751 ACTGCCCCAGGGAGAGGGTCCGG - Intronic
1173073973 20:39798369-39798391 CCTTCCTCTGAGAAAGGGAGTGG - Intergenic
1173151696 20:40571744-40571766 CCTGGCCCAGGGAGAAGGTGTGG + Intergenic
1173624912 20:44465732-44465754 CCTGCTTCAGGGAGGTGGTGTGG + Intergenic
1173761205 20:45562179-45562201 CATTCCTCCAGGAGAAGGTGGGG + Exonic
1173949377 20:46978380-46978402 GCTTACTCAGGGAGAGCCTGGGG + Intronic
1174364198 20:50046625-50046647 GCTTCTTCAGGGACTGGGTGTGG + Intergenic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1175263971 20:57691576-57691598 GCTTCCTCAGGGATGGGGTAGGG + Intronic
1176309920 21:5144086-5144108 CTTACCTCAGGGAGTGGATGAGG + Exonic
1176310075 21:5144826-5144848 CCTTCCCCAGGGCGGGGTTGGGG + Intronic
1178492384 21:33060976-33060998 CCTGCCCCTGGGAGAGGGGGTGG - Intergenic
1178608209 21:34057551-34057573 CCTACCCCAGGGAGGGGGTCTGG - Intergenic
1179846981 21:44117206-44117228 CCTTCCCCAGGGCGGGGTTGGGG - Intronic
1179847136 21:44117946-44117968 CTTACCTCAGGGAGTGGATGAGG - Exonic
1180999999 22:19983582-19983604 CCTGCCTGTGGGAGAGGGGGAGG - Intronic
1181349511 22:22245013-22245035 CGTTCCTCAGGGTGCAGGTGAGG - Exonic
1181939535 22:26464555-26464577 CCTTCCCCAGGGAGGAGCTGAGG + Exonic
1182427524 22:30282826-30282848 GGTCCCTCAGGGAGAGGGAGGGG - Intergenic
1183382137 22:37495650-37495672 CCATCCTCTGGGACAGGGCGGGG - Intronic
1183439201 22:37813632-37813654 CCTTCCCCAGGCGGAGGCTGAGG - Intronic
1183741515 22:39671016-39671038 CCCACCCCAGGGATAGGGTGGGG + Intronic
1183748538 22:39706027-39706049 CCTTTTTCTGGGAGAGGCTGGGG - Intergenic
1183830917 22:40418011-40418033 CCTGCCCCGGGGAGAGGCTGTGG - Intronic
1184687946 22:46104834-46104856 CCATCCTCAGGAAGAGGGCAGGG + Intronic
1184769424 22:46588913-46588935 CCTTACTGTGGGAGGGGGTGGGG - Intronic
1184837366 22:47031860-47031882 CGTCCCTCAGGGAGGGGCTGAGG + Intronic
1185208617 22:49554269-49554291 CCTGGCACAGGGACAGGGTGGGG + Intronic
949620786 3:5809615-5809637 CCCTCCTCAGGGTGAGGTGGGGG - Intergenic
950166011 3:10799519-10799541 TTTTCTTCAGGAAGAGGGTGGGG - Intergenic
950464562 3:13145682-13145704 GCCTCCTCTGGGACAGGGTGTGG - Intergenic
950574400 3:13823128-13823150 CCTGCCTCGGGGAGAGGGCTGGG - Intronic
950673415 3:14540374-14540396 CCCTCCCCAGGGAGGGGCTGTGG + Exonic
952277635 3:31892700-31892722 GCTGCCTGAGGGAGAGGGAGAGG + Intronic
952919202 3:38273445-38273467 CCTTCCTCAGGGCATGTGTGAGG + Intronic
954248017 3:49346950-49346972 CCCTCTTCGGGCAGAGGGTGTGG + Intergenic
954631474 3:52049940-52049962 CCTCCCTGAGGCAGAAGGTGGGG - Exonic
954639659 3:52090455-52090477 CCTTCCTTAGGGCAAGGGGGTGG - Intronic
954674352 3:52307497-52307519 TCTTCTTCAGGGAGAGGAGGTGG + Intergenic
954713375 3:52515697-52515719 ACTCCCCCAGGGAGAGGGAGTGG + Intronic
954776059 3:53019601-53019623 ACTTGCTCATGGACAGGGTGAGG - Intronic
954877478 3:53811643-53811665 CCATCCTCTGTGAGAGGGCGGGG - Exonic
954925540 3:54231132-54231154 GCCTCCCCAGGGAGAGGATGAGG + Intronic
955770632 3:62381369-62381391 TTTTGCTCTGGGAGAGGGTGGGG + Intergenic
956178856 3:66500098-66500120 TCGTACTCAGGGAGGGGGTGCGG - Intronic
957649218 3:82977998-82978020 CATTCCTCAGAGAGAGGGCAAGG + Intergenic
959833643 3:110893133-110893155 CCTACCTCATGGAGAAGGTCAGG + Exonic
959888259 3:111526754-111526776 ACTTCCTCAGAGACAGGCTGTGG + Intronic
961234586 3:125354959-125354981 CATTGCTGAGGGAAAGGGTGTGG - Intronic
961922957 3:130447029-130447051 CAATCCTCAGGGACAGGCTGTGG - Intronic
962164955 3:133038719-133038741 CCCTCCCCAGGTGGAGGGTGCGG + Intronic
964450806 3:156810824-156810846 CCATCCTCGAGGAGAGGGTGAGG + Intergenic
965699060 3:171440705-171440727 TCTTCTGCAGGAAGAGGGTGTGG + Intronic
967113484 3:186316675-186316697 CCTTCTATAGGGTGAGGGTGGGG - Intronic
967121400 3:186385624-186385646 CCTCCCTGAGTCAGAGGGTGGGG + Intergenic
967970262 3:194994214-194994236 CCTTCCTCCGTGAGAGGGGCTGG - Intergenic
968153052 3:196354343-196354365 TGTTCATCAGTGAGAGGGTGTGG - Exonic
968578548 4:1379104-1379126 GCATCCTCAGGCACAGGGTGTGG + Intronic
968739481 4:2320055-2320077 CCTTCCTCACAGAGAGGAGGAGG + Intronic
969057534 4:4411385-4411407 CCTTCCAGTGGGACAGGGTGTGG - Intronic
969104566 4:4795734-4795756 CGCTCCTCAGGGAGAGCTTGTGG + Intergenic
970845893 4:20536966-20536988 CCTTCCACTGGGACAAGGTGTGG - Intronic
972848925 4:43024412-43024434 CCTTCCTAGGGGAAAGGGGGTGG + Intronic
975195800 4:71521731-71521753 ACTTCCTAAGGCAGAGAGTGTGG + Intronic
975942832 4:79668378-79668400 CCTCACTCAAGGAGAGGCTGAGG + Intergenic
976281675 4:83332811-83332833 CCTTTCTTGGGGAGAGGTTGGGG + Intronic
977962437 4:103101171-103101193 CCTACCTCAGGGATGTGGTGAGG + Intergenic
978368380 4:108006169-108006191 CTTTCCTTAGGGAGTGTGTGGGG + Intronic
979547290 4:121952053-121952075 CGTTACTCAGGGAGAAGGAGAGG + Intergenic
980120239 4:128720538-128720560 CCTCCTTCAGGGAGGGGGAGGGG + Intergenic
982705146 4:158700865-158700887 CCTTCCTTAGGAAGAGTGAGAGG + Intronic
985447153 4:190029664-190029686 CCTTCCAGAGGGACAGAGTGAGG - Intergenic
985658514 5:1144129-1144151 CCACCCTCAGGGAGAGGACGTGG + Intergenic
985938023 5:3111621-3111643 CCTTCCTCAGGGGATGGGGGTGG - Intergenic
986118380 5:4803844-4803866 CCCTCCACACGGAGAGGATGGGG - Intergenic
986264584 5:6181151-6181173 CCTTCCTCAGGATGGAGGTGAGG - Intergenic
986886058 5:12237969-12237991 CCTCCCACAGAGAGAGGGAGAGG + Intergenic
986938463 5:12919846-12919868 GCTTCCTCAGTGGTAGGGTGAGG - Intergenic
987001019 5:13659733-13659755 CCTTCCTCTGAGAGAGGCCGTGG - Intergenic
988581592 5:32473416-32473438 CCTTAATCAGGGGGATGGTGGGG + Intergenic
988725169 5:33919710-33919732 GCTTTCTCAGGTAGTGGGTGGGG + Intergenic
989237333 5:39164105-39164127 ACATCCTCAGGGAGAGAGAGGGG + Intronic
990515563 5:56528088-56528110 AGTTTCTCAGGGACAGGGTGGGG - Intronic
991302619 5:65144225-65144247 CCTGGCTCAGGGAGAAGTTGGGG + Intergenic
992008200 5:72500126-72500148 TCTTCCTCAGGGAGAAAGGGAGG - Intronic
992065385 5:73103056-73103078 CCTTCCAGTGGGATAGGGTGTGG - Intergenic
992159322 5:73985212-73985234 CCCTCTTGTGGGAGAGGGTGGGG - Intergenic
993308474 5:86298542-86298564 CCTTTCTCAGAAAGAGAGTGTGG - Intergenic
993633637 5:90317936-90317958 CCTTCCCCAGTGACAGGGTTTGG - Intergenic
996091351 5:119355259-119355281 CCTTCCTCAGGGGGAGAGCACGG - Intronic
996095926 5:119399206-119399228 CCTTCCTCTGGGAGAGGCACTGG + Intronic
996551431 5:124734581-124734603 CCTCCCTCAGCGAGCGGCTGGGG - Intronic
997894547 5:137704450-137704472 CCTTGCACTGGGAGATGGTGTGG - Intronic
998083203 5:139293788-139293810 CCTACCTTAGGGAAAGGGAGAGG - Intronic
999145442 5:149390223-149390245 CTTTCCCCAGGGACAGGGAGGGG - Intronic
1001098398 5:168794226-168794248 CTTTCCTCTGTGGGAGGGTGAGG + Intronic
1001450602 5:171821506-171821528 CAGAACTCAGGGAGAGGGTGTGG - Intergenic
1001892244 5:175349374-175349396 GCTTTCTCAGGGAGCAGGTGAGG - Intergenic
1002048459 5:176555321-176555343 CCTGCCTCAGGGAGAGGCGAGGG + Intronic
1002319227 5:178365249-178365271 CCCTGCTCAGGCAGATGGTGTGG + Intronic
1003147514 6:3521118-3521140 CTTCCTTCAAGGAGAGGGTGAGG + Intergenic
1004271861 6:14202831-14202853 CCTCACACAGGGAGAGGGAGAGG + Intergenic
1004330545 6:14716762-14716784 CTTTCCTCAGAGAAAGGCTGTGG - Intergenic
1004760008 6:18656313-18656335 CCTCCCTTAGCTAGAGGGTGGGG - Intergenic
1005253296 6:23972274-23972296 CCTTCTTCTGGGAGTGGGTTGGG - Intergenic
1006812518 6:36829155-36829177 CCTTCCTTGAGGAGAGAGTGGGG + Intronic
1010492270 6:76490376-76490398 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1011143144 6:84182656-84182678 CCTACCTCATGGACAGGGTCCGG + Intronic
1012638401 6:101578040-101578062 CCTTTCTAAGGGAGAACGTGAGG - Intronic
1013453429 6:110307845-110307867 TCTTCCTCATAGAGAGGGAGAGG - Intronic
1014004626 6:116403959-116403981 CCTTGATCAGGGAGGGAGTGGGG + Intronic
1014909437 6:127072695-127072717 CCTTCTTGAGGGTGAGGGTCAGG - Intergenic
1015558030 6:134483003-134483025 CCTTCCTCAGGGACAGATTACGG + Intergenic
1016705196 6:147099015-147099037 GCTTCCTCATGGACAGGGGGAGG - Intergenic
1018387921 6:163321785-163321807 CCCTCCGCGGGGAGAGGGTGCGG - Intergenic
1018674602 6:166207864-166207886 CCTGCCTCTGGGAAAGGGAGTGG + Intergenic
1019215738 6:170442698-170442720 CCCTGCTCAGGGCCAGGGTGTGG + Intergenic
1019316897 7:391058-391080 CCTTCCTTGGGGAGCGGGAGGGG + Intergenic
1019699298 7:2466077-2466099 CATCACTCAGGGAGAGGGAGTGG - Intergenic
1021952170 7:25785760-25785782 CATGCCTCAAGGAGAGGATGAGG + Intergenic
1022066507 7:26864380-26864402 ATTTCCTCAGGGAGGGGGTAGGG + Exonic
1022410774 7:30136643-30136665 CCCTCCTCAGGGGGTGCGTGTGG - Intronic
1025899675 7:65733626-65733648 CCTTGCTCTGGAAGAGGGAGAGG - Intergenic
1026891179 7:73983764-73983786 CCTGCCTCAGGGGGAGGCAGGGG - Intergenic
1029336226 7:99902020-99902042 ACTCCCTCAGGCAGAGGGTAGGG + Intronic
1029443206 7:100599642-100599664 CCTTCCTCAGGGTGGTGTTGGGG + Intronic
1030354298 7:108525904-108525926 ACTTCCCGAGCGAGAGGGTGGGG - Intronic
1032383414 7:131505873-131505895 CCTTCCTCTGGGAGAGGCGCTGG + Exonic
1032648688 7:133854226-133854248 TGTTCCTCAGGGTGAGGCTGGGG + Intronic
1032696232 7:134338855-134338877 GCTTCCTCAGACAGAGGCTGAGG - Intergenic
1033230958 7:139597013-139597035 CCTTCCTCTGTGTGAGAGTGTGG - Intronic
1033595510 7:142855518-142855540 CCTTCCTCAAGGCCAGAGTGGGG + Intronic
1033854922 7:145548548-145548570 TCATCCTCATGGAGATGGTGGGG + Intergenic
1034283117 7:149867085-149867107 CAGTCATCAGGGAGAGGGAGGGG - Exonic
1034554237 7:151839833-151839855 CCTTCCCCAGGGACACCGTGTGG + Intronic
1034893486 7:154860192-154860214 GGTGCCTCAGGGAGAAGGTGGGG - Intronic
1034973783 7:155436330-155436352 CCTTCCAGAGGGTGAGGGAGGGG - Intergenic
1035412744 7:158658190-158658212 CCTACCACAGGGAGAGGGAAGGG + Intronic
1036484723 8:9169223-9169245 CATTCCCCACGCAGAGGGTGGGG - Intergenic
1037810040 8:22081568-22081590 CTTTCCTCAGGTAGAGTGGGGGG + Exonic
1040811742 8:51461343-51461365 GCTCCCTCAGGCAGAGGCTGTGG - Intronic
1041820352 8:62024988-62025010 CTTTCCTCAGAGAAAGGATGTGG + Intergenic
1042813097 8:72847248-72847270 ACTTTCTCAGGAAGAGGTTGGGG + Intronic
1042867757 8:73370503-73370525 TCTTCCTCAGAGAGAGAGGGCGG - Intergenic
1046201104 8:110928822-110928844 CCTCTCTCTGGGAGATGGTGGGG + Intergenic
1047303567 8:123635490-123635512 CCTTCCTCATGCAGATAGTGCGG + Intergenic
1049296880 8:141845488-141845510 GCTTCCTCAGGGGTGGGGTGGGG - Intergenic
1049436327 8:142587756-142587778 CCTGCCTGTGGGCGAGGGTGGGG - Intergenic
1049554211 8:143274141-143274163 GCTTCCTCAGGCAGAGCCTGAGG - Intronic
1049693983 8:143974775-143974797 CCTGGCTCAGGAAGAGGCTGGGG + Intronic
1049934230 9:485159-485181 CTGTCTTCAGGGAGTGGGTGTGG + Intronic
1050345271 9:4679803-4679825 CCTCCCTCGGGCCGAGGGTGAGG + Exonic
1050451958 9:5791336-5791358 CCTTCCCCAAGGAGAGGGAATGG - Intronic
1052981521 9:34453422-34453444 CCCTGCTTTGGGAGAGGGTGAGG - Intronic
1053147461 9:35721489-35721511 TCTTCCTCTGGGAGAGTGTGAGG - Intronic
1053160397 9:35809974-35809996 CCTTCCTCCGGGACAGGGAAGGG + Intronic
1053412749 9:37926194-37926216 CCATCCTCAGGGTGGGGGTGGGG - Intronic
1053428389 9:38026044-38026066 CCTTCCTTGGGAAGGGGGTGGGG - Intronic
1054737498 9:68770290-68770312 CCTTCCTGAGGGAGAGGAGTAGG - Intronic
1057128563 9:92637967-92637989 CCTTCCCCAGGTAGGCGGTGGGG - Intronic
1061260670 9:129479184-129479206 CCTGCCTGAGGCAGAGGGTGTGG - Intergenic
1061389313 9:130308565-130308587 CCTTTCTCAGAGTCAGGGTGAGG - Intronic
1062066298 9:134528342-134528364 CCTTTCTGAGAGGGAGGGTGAGG + Intergenic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062362915 9:136195985-136196007 CCTCTCCCAGGGACAGGGTGTGG + Intergenic
1187768433 X:22668835-22668857 CCTCCTTCAGGGACATGGTGAGG - Intergenic
1188137225 X:26504945-26504967 CCTGCTTCAGGTAGAGGGGGTGG - Intergenic
1189284071 X:39839531-39839553 CCTGCCCCGGGGTGAGGGTGGGG - Intergenic
1189339233 X:40192028-40192050 ACTGCCTCAGGGAGAGGGTATGG - Intergenic
1189365003 X:40381213-40381235 CCCTCCTCAGGGCCAGGGTATGG - Intergenic
1189639241 X:43050274-43050296 GCTTCCTCAGAGCTAGGGTGTGG + Intergenic
1191125159 X:56946666-56946688 CAATCCTCAGGGACAGGCTGTGG + Intergenic
1192168075 X:68838460-68838482 CCATCCTCAGGCTGGGGGTGGGG - Intronic
1196384837 X:115138118-115138140 CCTGCCTTAGGGAGAGGAAGGGG - Intronic
1196759580 X:119189528-119189550 CCTGCCTCAGGAGGATGGTGAGG - Intergenic
1196784647 X:119411169-119411191 CCTTCCTCAGCGAGGGAGTCAGG - Intronic
1197958206 X:131975745-131975767 CCTTCCTCATGTAGTGGTTGTGG - Intergenic
1200067642 X:153511862-153511884 GCTTCCTCGGGGAGTGGCTGTGG + Intergenic
1201475553 Y:14377447-14377469 CAATCCTCAGGGACAGGCTGTGG - Intergenic