ID: 1137711248

View in Genome Browser
Species Human (GRCh38)
Location 16:50568337-50568359
Sequence GTGGTAGGCCAGCCTATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137711241_1137711248 7 Left 1137711241 16:50568307-50568329 CCGCATATCAGAGAGGGGAAGAA 0: 1
1: 0
2: 1
3: 20
4: 284
Right 1137711248 16:50568337-50568359 GTGGTAGGCCAGCCTATGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105
1137711238_1137711248 13 Left 1137711238 16:50568301-50568323 CCAGGACCGCATATCAGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1137711248 16:50568337-50568359 GTGGTAGGCCAGCCTATGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137711248 Original CRISPR GTGGTAGGCCAGCCTATGGG GGG Intronic
900497365 1:2982134-2982156 GTGGCAGGCCAGCCAGTGTGCGG + Intergenic
900837106 1:5013662-5013684 GTGGTTGGCCATCCTGGGGGTGG - Intergenic
901028194 1:6290375-6290397 GTGGCAGATCAGCCTGTGGGAGG + Intronic
901167806 1:7232190-7232212 GTGGTTGGCCAGCAGATGGAGGG + Intronic
902623268 1:17662672-17662694 GGGGTAGGCCAGGGTATGGTAGG + Intronic
905626813 1:39494891-39494913 GTGGAAGCCCAGGCTGTGGGTGG + Intronic
905670129 1:39785928-39785950 GTGGAAGCCCAGGCTGTGGGTGG - Intronic
916935845 1:169627253-169627275 TTGGTAGCCCAGCTTAGGGGTGG + Intronic
920036885 1:203071852-203071874 TTGGAAGGCTAGTCTATGGGAGG + Intronic
924149836 1:241117901-241117923 GTGTTAGTCCAGCCTATGCCTGG - Intronic
1065525778 10:26619547-26619569 TTGGTAGGACAGCCTCTGTGTGG + Intergenic
1065703065 10:28444261-28444283 GTGTCAGGCCAGCCAGTGGGTGG + Intergenic
1066802744 10:39208513-39208535 ATGGCTGGCCAGCTTATGGGGGG - Intergenic
1067069172 10:43119813-43119835 GTGGCAGGCCAGGGTGTGGGTGG - Intronic
1071954346 10:90741626-90741648 GTTATGGGCCAGCCCATGGGTGG + Exonic
1073037318 10:100573133-100573155 GTGGCAGCTCAGCCTCTGGGTGG + Intergenic
1077882789 11:6364144-6364166 ATGGGAGGCCTGCCTATGGGAGG - Intergenic
1079406994 11:20156370-20156392 GTGGTAGGCCAGGCGGTGGCTGG + Exonic
1080645824 11:34186793-34186815 CTGGGAGGCCAGCCTGGGGGTGG - Intronic
1082169603 11:48987425-48987447 GTGGGAGTGCTGCCTATGGGTGG + Intergenic
1082234613 11:49808644-49808666 GTGGGAGTGCTGCCTATGGGTGG - Intergenic
1084092731 11:66889267-66889289 GTTGCAGGGCAGCCTCTGGGAGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1087082905 11:94188983-94189005 GTGGTAAGCCAGCATCTTGGCGG + Intergenic
1091793196 12:3283222-3283244 GGGGTAGGGCAGGCTGTGGGGGG - Exonic
1092263178 12:6963138-6963160 GTGGGGGGGCAGCCTATGGCAGG + Intergenic
1098985236 12:77005037-77005059 TCAGTATGCCAGCCTATGGGTGG - Intergenic
1099567362 12:84269540-84269562 GTGGTAAGACAGGATATGGGAGG + Intergenic
1100773370 12:97948491-97948513 GTGCTAAGTCAGCCTCTGGGTGG + Intergenic
1102577192 12:113863233-113863255 GTGTGGGGCCAGCGTATGGGTGG + Intronic
1103201799 12:119093882-119093904 TTGATAGGCCAGCCTGTGGAGGG + Intronic
1104195371 12:126532179-126532201 GAGGTAGGTCAGCCTTTGGGAGG - Intergenic
1105446496 13:20461961-20461983 GTGGGAGGGCAGCCTGGGGGAGG + Intronic
1106140493 13:27007067-27007089 GTGGTAAGCAAGCCTAAGGAGGG - Intergenic
1107070482 13:36262839-36262861 GTGGTTGGCCAGTCTATGTAAGG + Intronic
1130247161 15:82262560-82262582 CTCCTAGGCCAGCCTTTGGGCGG - Intronic
1130553201 15:84905114-84905136 CTGGGAGTCCAGCCTATTGGAGG + Intronic
1132094293 15:98970630-98970652 GAGGGTGGCCAGCCTAGGGGAGG - Intronic
1132321051 15:100925892-100925914 ATGCTAGGCCACACTATGGGAGG + Intronic
1137711248 16:50568337-50568359 GTGGTAGGCCAGCCTATGGGGGG + Intronic
1142479974 17:213310-213332 GTCCTGGGCCAGCCCATGGGAGG + Exonic
1142766631 17:2068059-2068081 GTGGTGGGTCAGCCTCAGGGTGG - Intronic
1147591930 17:41689263-41689285 GCGGTAGGTCAGCCCTTGGGCGG + Intronic
1148961377 17:51396147-51396169 GTGGTACTCCTGCCCATGGGGGG - Intergenic
1150864023 17:68830965-68830987 GTGGTAGTTCAACCTATTGGTGG - Intergenic
1152422817 17:80203300-80203322 GTTCTAGATCAGCCTATGGGAGG + Intronic
1153543985 18:6186822-6186844 GTGGGAGGCCAGCAGATGTGGGG + Intronic
1153954698 18:10086431-10086453 GTGGTGTGCCACCCTCTGGGAGG + Intergenic
1154487346 18:14883650-14883672 GAGGTAGGGCAGCCAAAGGGAGG + Intergenic
1156045726 18:32875002-32875024 GAGCTAGGCCAGGCTATGGAAGG + Intergenic
1162923723 19:13919092-13919114 GTGTTAGGGCTGCCTGTGGGAGG - Intronic
1165735277 19:38171918-38171940 CAGGTAGGGCAGCCAATGGGAGG + Intronic
1165753264 19:38274839-38274861 GAGGTAGACCAGCTTACGGGAGG + Intronic
1166845101 19:45722419-45722441 ATGGTCAGCCAGCCCATGGGTGG - Intronic
930222138 2:48755744-48755766 GTGGAAGGGCAGCCAAGGGGCGG - Intronic
930402015 2:50901940-50901962 ATGGAAGGACAGCATATGGGAGG - Intronic
933726224 2:85429258-85429280 GGGGGAGGCCCGCCTAGGGGAGG + Intronic
937839415 2:126510879-126510901 GTGGTGGGCGTGGCTATGGGAGG - Intergenic
942498318 2:176562555-176562577 GTTGCTGGCCAGCCTATGGATGG + Intergenic
943753269 2:191532041-191532063 ATGGAAGGGCAGCATATGGGTGG + Intergenic
1174012443 20:47461265-47461287 GTGTTAGGGCATCCTATGGGGGG - Intergenic
1176512418 21:7758867-7758889 ATGGGAGGGCAGCCTATGAGGGG - Intronic
1176793935 21:13355685-13355707 GAGGTAGGGCAGCCAAAGGGAGG - Intergenic
1178646530 21:34389391-34389413 ATGGGAGGGCAGCCTATGAGGGG - Intronic
1181022141 22:20109213-20109235 CTGGCAGGCCAGCCTGTTGGTGG + Intronic
1182503276 22:30764153-30764175 AGGGTAGGCGAGCCTAGGGGAGG - Intronic
1183457301 22:37929823-37929845 GTGGCAGGACAGCCTTTGTGGGG + Intronic
950557020 3:13702175-13702197 GAAGTAGCCCAGGCTATGGGTGG - Intergenic
960674850 3:120184056-120184078 GGGGTAGGCCAGACTAGGGCAGG - Intronic
961375517 3:126462921-126462943 GTGGTAGGGGAGGCTGTGGGAGG - Intronic
967750871 3:193114927-193114949 GTGGCAGGACAGGTTATGGGAGG + Intergenic
967853853 3:194101830-194101852 GTGGGAGGACAGCCTGAGGGTGG - Intergenic
968073387 3:195802064-195802086 GGGTGAGGCCAGCATATGGGTGG - Intronic
969861997 4:10044119-10044141 GTGGAAAGGCAACCTATGGGAGG + Intronic
981089970 4:140722112-140722134 GTAGCAGGGGAGCCTATGGGGGG + Intronic
984141236 4:176005864-176005886 GTGGCAAGACAGCTTATGGGAGG + Intergenic
989141620 5:38207301-38207323 GTGGCAGGTCAGCCAAGGGGTGG + Intergenic
994898800 5:105744226-105744248 GGGGTAGGGCAGGCCATGGGTGG - Intergenic
997453206 5:133999942-133999964 GAACTAGGCCAGCCTATAGGAGG + Intronic
998402011 5:141853042-141853064 GTGGGAGGCCAGCCTGAGCGGGG + Intergenic
1002473395 5:179450884-179450906 GGGGTTGGCCAGCCTAACGGTGG - Intergenic
1006378934 6:33686815-33686837 GGTGAAGGCAAGCCTATGGGTGG + Intronic
1007192424 6:40030920-40030942 GTGGTGGTCCATCCTAGGGGTGG + Intergenic
1008106648 6:47446062-47446084 TTGGTAGGCCAGCAGTTGGGTGG + Intergenic
1012248390 6:96952901-96952923 GTGCTGGGACAGCCTCTGGGTGG - Intronic
1013185072 6:107750287-107750309 GTGGTATGTCAGCCTCTTGGAGG - Intronic
1017986818 6:159450950-159450972 GTGGCAGGCCAGCCTGTGCCAGG - Intergenic
1020719414 7:11722518-11722540 GTGCTAAGTCAGCCTCTGGGTGG - Intronic
1021688970 7:23213980-23214002 GTGGTCGGCCAGCACCTGGGCGG + Intergenic
1022501467 7:30884650-30884672 GTGGTGGGCCACCCCCTGGGAGG - Intronic
1023052175 7:36262615-36262637 GTGGTCTGCCAGCATTTGGGAGG + Intronic
1023254406 7:38298888-38298910 GTGGCAGGACAGCCTAGGGAGGG - Intergenic
1024041523 7:45559735-45559757 GTGCTAAGCCAGCCTCTGGGTGG - Intergenic
1025789915 7:64679933-64679955 GTGGTAGGGGAGCAGATGGGCGG - Intronic
1038393921 8:27232652-27232674 GGTGTAGGCCAAACTATGGGAGG + Intergenic
1049671862 8:143873557-143873579 GTGGAAGGACAGCCTGCGGGAGG - Intronic
1050020975 9:1284442-1284464 AGGGCAGGCCAGCCAATGGGAGG - Intergenic
1055471660 9:76617836-76617858 GTGGAAGCCCAGCCAATGGCTGG - Intronic
1059757757 9:117309788-117309810 GTGGGAGGCAAGCAGATGGGTGG + Intronic
1060783217 9:126428996-126429018 GTGGTGGGTGAGCGTATGGGAGG + Intronic
1192160387 X:68782038-68782060 GTGGCAGGACAGGTTATGGGAGG + Intergenic
1192161461 X:68791311-68791333 GTGGCAGGACAGGTTATGGGAGG - Intergenic
1192796192 X:74425590-74425612 GTGGTAGGGAAGCCTTTTGGAGG + Intronic
1193979922 X:88169311-88169333 GTGGTAGGCCAGCAGAAAGGGGG + Intergenic
1197258686 X:124292654-124292676 GTGTTTGGCAAGACTATGGGAGG + Intronic
1197613180 X:128661359-128661381 GTTGTATGCCAGCTTAGGGGAGG + Intergenic
1200181791 X:154155295-154155317 GTGGTAGCCTAGTCTAGGGGTGG - Intronic
1200187440 X:154192409-154192431 GTGGTAGCCTAGTCTAGGGGTGG - Intergenic
1200193089 X:154229549-154229571 GTGGTAGCCTAGTCTAGGGGTGG - Intronic
1200198844 X:154267353-154267375 GTGGTAGCCTAGTCTAGGGGTGG - Intronic