ID: 1137712448

View in Genome Browser
Species Human (GRCh38)
Location 16:50575793-50575815
Sequence CCACCATTTGTTGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137712446_1137712448 -6 Left 1137712446 16:50575776-50575798 CCTAAATTCTGGTGTGGCCACCA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1137712448 16:50575793-50575815 CCACCATTTGTTGCATCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 119
1137712445_1137712448 -1 Left 1137712445 16:50575771-50575793 CCAGGCCTAAATTCTGGTGTGGC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1137712448 16:50575793-50575815 CCACCATTTGTTGCATCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137712448 Original CRISPR CCACCATTTGTTGCATCCTT TGG Intronic
901687153 1:10949333-10949355 CCACCCTCTGCTGCCTCCTTTGG + Intronic
907963649 1:59307968-59307990 CCAGCATGTGTTGCATCCAGGGG + Intronic
911862003 1:102963350-102963372 TGACCATTTGTTACAGCCTTTGG - Intronic
913079204 1:115366086-115366108 ACACCATTTGTTTCTTCTTTGGG - Intergenic
914877088 1:151520239-151520261 CCACCATCTATGGCATCCTGAGG + Exonic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919345526 1:196371334-196371356 CCACCAATTCTTGCAGCCCTAGG - Intronic
921728334 1:218549161-218549183 CCACCATGGTTTGAATCCTTTGG - Intergenic
921776660 1:219108736-219108758 TCACTATTTTTTGCATTCTTTGG + Intergenic
922371061 1:224910784-224910806 CCACTACTCCTTGCATCCTTAGG - Intronic
923535636 1:234849246-234849268 CGACCATTTTTTGCATCTTTAGG - Intergenic
924830228 1:247586346-247586368 ACACAATTTGTTGCCTGCTTGGG + Intergenic
1070732673 10:78842172-78842194 CCACCTTTTCCTGCCTCCTTAGG - Intergenic
1071125975 10:82335257-82335279 CCATCATTGGTTATATCCTTAGG - Intronic
1073751873 10:106538322-106538344 GCACCATTTGTTGCATTGGTAGG - Intergenic
1077349983 11:2088576-2088598 CCACCATTGGAAGCAACCTTAGG - Intergenic
1085232213 11:74982086-74982108 CCATCATTTATTTCATCTTTGGG - Intergenic
1089336426 11:117726951-117726973 CCAACATTTGTAGCATGCTATGG - Intronic
1091281078 11:134382032-134382054 CCACCATGTTTTGCATCTCTGGG - Intronic
1092990741 12:13896464-13896486 CGTCCATTTTTTGCTTCCTTTGG - Intronic
1100068015 12:90674363-90674385 CTACCATTTGCTACATACTTCGG - Intergenic
1101442529 12:104714286-104714308 CCTCAATCTGCTGCATCCTTTGG - Intronic
1102815183 12:115859612-115859634 CCACCATCCCTTGCATCCCTTGG + Intergenic
1103216687 12:119207224-119207246 CCACCTTCTGTTGCATTCCTTGG + Intronic
1107150556 13:37105817-37105839 CCACAATCTCTTGCAACCTTAGG - Intergenic
1107385716 13:39906762-39906784 CCACCATTTATTGAGGCCTTTGG + Intergenic
1107417372 13:40213069-40213091 CAACCATATGTTGCATCCAATGG + Intergenic
1108423132 13:50271205-50271227 CCACCTTTTCTTCCATCCATGGG - Intronic
1113419460 13:110159245-110159267 CCACCAGTTTTTGCTCCCTTGGG - Intronic
1114584563 14:23798486-23798508 CCAACATTTGTTCCAGCCCTTGG - Intergenic
1115146254 14:30229385-30229407 CCACAACTTGTTTCATGCTTTGG - Intergenic
1117569676 14:57034454-57034476 ACTCCATTAGTTGCATTCTTGGG - Intergenic
1117900886 14:60531718-60531740 CCATTATTTGTTGCATCCGTAGG - Intergenic
1121055622 14:90849779-90849801 TCACCCTTTGTTCCATCTTTGGG - Exonic
1123496324 15:20830726-20830748 CCACAATTTGGAGCATTCTTTGG + Intergenic
1123553559 15:21404295-21404317 CCACAATTTGGAGCATTCTTTGG + Intergenic
1123589804 15:21841681-21841703 CCACAATTTGGAGCATTCTTTGG + Intergenic
1124874558 15:33579858-33579880 GCACCATGAGTTGCTTCCTTGGG - Intronic
1128331090 15:66756126-66756148 CCCTCATTTGTTGTATCCATGGG + Intronic
1202961905 15_KI270727v1_random:131517-131539 CCACAATTTGGAGCATTCTTTGG + Intergenic
1137712448 16:50575793-50575815 CCACCATTTGTTGCATCCTTTGG + Intronic
1140271110 16:73467015-73467037 CCTCCCTTTGTCCCATCCTTAGG - Intergenic
1142779950 17:2173878-2173900 CCACAATTTGTAGTATCCCTGGG - Intronic
1145098235 17:20050326-20050348 ACACCATTTGTTGGTTCCTTTGG + Intronic
1152373469 17:79905081-79905103 ACACAAAGTGTTGCATCCTTGGG - Intergenic
1154454237 18:14506415-14506437 CCACAATTTGGAGCATTCTTTGG + Intergenic
1155114066 18:22747522-22747544 GAATCATTTTTTGCATCCTTGGG - Intergenic
1155633077 18:27918545-27918567 CCACTAATTTTTGCATCCATTGG - Intergenic
1157950654 18:52033335-52033357 CCACCATGAGTTTCATCATTAGG - Intergenic
1164534220 19:29072979-29073001 CCCCCATTGGTTGCAACCTCTGG - Intergenic
1167819626 19:51915231-51915253 CCCACATTCGTTGCATCCATAGG + Intronic
931379351 2:61737770-61737792 CCACCATTTGTTAACTCCTTTGG + Intergenic
933743529 2:85553393-85553415 GCAACAGTTGTTGCAACCTTCGG + Exonic
933762505 2:85682036-85682058 CCACCATTTGTATCAGGCTTTGG - Intergenic
936377873 2:111957790-111957812 CTTCCATTTGTTGCTTCCTTTGG + Intronic
936607557 2:113973404-113973426 CCACCATCTGTTGCCTCTTCTGG - Intergenic
937113403 2:119385077-119385099 CCACCATCAGGTGCAGCCTTGGG - Intergenic
938206484 2:129428693-129428715 TCTCCATTTGTTACAGCCTTTGG + Intergenic
940721761 2:157290356-157290378 CCAGCATTGGATGTATCCTTGGG - Intronic
941783297 2:169472678-169472700 CCACAATTTGTTTCATCTTTTGG - Intergenic
942931147 2:181494317-181494339 CCACCATGTCTGGCCTCCTTAGG - Intronic
943664085 2:190590139-190590161 CCTCCCTTTGTTGCAACTTTTGG - Intergenic
944179553 2:196874444-196874466 CCACTATTTTTAGCATCCATTGG - Intronic
948485884 2:238280489-238280511 CCATCATTTCTTGAATTCTTAGG - Intronic
1172267502 20:33629406-33629428 GCAGCATTTGTTGTATCCCTAGG - Intronic
1173159846 20:40644283-40644305 CCAACATTTCTAGCAGCCTTGGG + Intergenic
1174850078 20:53985386-53985408 CCCCGATGGGTTGCATCCTTTGG + Exonic
1176819932 21:13646872-13646894 CCACAATTTGGAGCATTCTTTGG - Intergenic
1179517782 21:41920871-41920893 CCAACATTTGATGCATGTTTTGG - Intronic
1181752878 22:25001848-25001870 CCTGCATTTATAGCATCCTTGGG + Intronic
1182371182 22:29812230-29812252 CCACCATTTGTAGCAGCTTCTGG - Intronic
1182735026 22:32527277-32527299 CTACCATTTTCTGCCTCCTTGGG + Intronic
953106086 3:39880735-39880757 CTACCATTTATTGCATTCTATGG - Intronic
953272096 3:41455714-41455736 CCTCCATCTATTCCATCCTTGGG - Intronic
953562947 3:44009031-44009053 CCACCATTAGTGGCATCCCTTGG - Intergenic
954624165 3:52013413-52013435 CCACCATTTGTGGAATGCCTGGG + Intergenic
955718721 3:61859492-61859514 CCCCCTTTTGTTCCTTCCTTTGG + Intronic
958069508 3:88592117-88592139 CCACCTTTTAATGCATCCTCAGG - Intergenic
958539892 3:95457799-95457821 GAAGCATTTGTTGCATCCTCTGG + Intergenic
961118671 3:124354148-124354170 CCCACATTTGCTGCTTCCTTTGG + Intronic
961676304 3:128569051-128569073 CCACCATTGGGTTCATTCTTTGG - Intergenic
965339338 3:167467375-167467397 TCACCGTTTTTTGCACCCTTAGG + Intronic
966083101 3:176029863-176029885 CCCACATTTCTTGCCTCCTTTGG + Intergenic
972786254 4:42329210-42329232 CCTCCATATGGTGCATCCTCTGG - Intergenic
972838314 4:42902217-42902239 CAAACATTTGTTGCTTCATTAGG - Intronic
974095073 4:57354054-57354076 ACACCATTTTATGCTTCCTTGGG - Intergenic
976541134 4:86277931-86277953 CCTTAATTTTTTGCATCCTTAGG - Intronic
976929068 4:90541021-90541043 CCACCATTTATTGATTCATTAGG + Intronic
982896694 4:160938678-160938700 TCATCAGTTGTTGCATACTTAGG - Intergenic
984379466 4:178971910-178971932 CCACCATTTCTGTCATCATTTGG + Intergenic
986841710 5:11705235-11705257 ACACAATGTGTAGCATCCTTTGG - Intronic
987611066 5:20203343-20203365 CCATGATTTGTTGTCTCCTTTGG - Intronic
991923546 5:71681417-71681439 CAGCCAGTTGTTGCATCCTCTGG - Intergenic
993797917 5:92292526-92292548 CCTCTAATTGTTGCTTCCTTTGG + Intergenic
994800301 5:104365516-104365538 CCACCATTTTTTTCATGATTTGG - Intergenic
996672427 5:126134326-126134348 CCACCATTTATTGAATACTTTGG + Intergenic
997219122 5:132144344-132144366 CCAACATCTGTTTCATCTTTGGG - Intergenic
998928193 5:147151026-147151048 CAACAATTTGTTTCTTCCTTTGG + Intergenic
1000020571 5:157315127-157315149 CCACCATGAGCTGCAGCCTTGGG - Intronic
1000975520 5:167760190-167760212 CCACAATTTATTGCACCCTTAGG - Intronic
1005376790 6:25190824-25190846 CAACTAGTTGCTGCATCCTTTGG - Intergenic
1005692656 6:28322239-28322261 CCACCTTCTGCTGCCTCCTTAGG + Intergenic
1007275423 6:40669825-40669847 CTACCATGTGTTCCAGCCTTGGG + Intergenic
1008075025 6:47136741-47136763 CCACCGTTTGTTGCTTCCTGGGG - Intergenic
1008158088 6:48042180-48042202 CCACCCTTTCTTTAATCCTTTGG + Intronic
1009036250 6:58120377-58120399 CCACCACTTTTTCCCTCCTTTGG + Intergenic
1011613494 6:89176738-89176760 CCACCATTTGAAGCAACCTATGG - Intergenic
1012171704 6:96024501-96024523 GCACCATCTATTTCATCCTTGGG + Intronic
1012930136 6:105307997-105308019 TCACCATCTTTAGCATCCTTTGG + Intronic
1015189786 6:130460134-130460156 CTTCTATTTGTTGCTTCCTTAGG + Intergenic
1015688763 6:135896676-135896698 CCATCATTTTTTGCATGCTTAGG - Intronic
1016405970 6:143731243-143731265 GAACCAGTTTTTGCATCCTTAGG + Intronic
1017618873 6:156274359-156274381 CCACCGTCTGTTTCTTCCTTGGG + Intergenic
1021098938 7:16566027-16566049 CCCTCATTTGTTGCAGACTTGGG + Intronic
1021285898 7:18780543-18780565 CCAGCATTGGGTGCTTCCTTTGG - Intronic
1024469726 7:49755045-49755067 CCACCCTCTGTTAAATCCTTGGG - Intergenic
1028393497 7:90341388-90341410 CCAACATTTGTTACATACTGAGG + Intronic
1032649220 7:133858965-133858987 CCATCTTTTGTAGCATCCTCTGG + Intronic
1038059030 8:23891908-23891930 CTACCATTTATTTCAGCCTTTGG + Intergenic
1042813835 8:72855828-72855850 CCACCAATTGTGGTATCCGTGGG - Intronic
1043421122 8:80099961-80099983 CCAGTATTTGTTGTATCATTGGG - Intronic
1045703976 8:104898813-104898835 CCACCATTTATTTCATGCCTGGG + Intronic
1046301947 8:112306153-112306175 CCTCCATTTGTTGGAGCTTTAGG + Exonic
1056457514 9:86774998-86775020 CCCCCACTGGTTGCATCTTTGGG - Intergenic
1059537355 9:115093843-115093865 CCACCAAATGTTGCATCGTTGGG + Intronic
1060374114 9:123103251-123103273 ACACCTTTTGTTGCCTTCTTTGG + Exonic
1203527429 Un_GL000213v1:102678-102700 CCACAATTTGGAGCATTCTTTGG + Intergenic
1187140428 X:16587982-16588004 CCACAATTTGTTTCACCTTTTGG - Exonic
1195238729 X:102929095-102929117 CCACTCTTTGGTGCATCCCTAGG - Intergenic
1195655486 X:107327915-107327937 CCACCATTGGATCTATCCTTTGG + Intergenic
1195809174 X:108811519-108811541 CCACCATTTTTTCCATCTTTTGG - Intergenic
1199317192 X:146394941-146394963 ACACCCTCTGTTGCTTCCTTGGG + Intergenic
1201943746 Y:19487722-19487744 CCACCATTTCTTACTTCCTCTGG - Intergenic