ID: 1137715434

View in Genome Browser
Species Human (GRCh38)
Location 16:50595514-50595536
Sequence GACATGCCCCTGGGTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137715434_1137715439 2 Left 1137715434 16:50595514-50595536 CCAGGAACACCCAGGGGCATGTC 0: 1
1: 0
2: 2
3: 11
4: 183
Right 1137715439 16:50595539-50595561 GAGAGCCCTGGCCTTCCTCTCGG 0: 1
1: 0
2: 3
3: 23
4: 293
1137715434_1137715440 3 Left 1137715434 16:50595514-50595536 CCAGGAACACCCAGGGGCATGTC 0: 1
1: 0
2: 2
3: 11
4: 183
Right 1137715440 16:50595540-50595562 AGAGCCCTGGCCTTCCTCTCGGG 0: 1
1: 0
2: 4
3: 64
4: 611
1137715434_1137715437 -10 Left 1137715434 16:50595514-50595536 CCAGGAACACCCAGGGGCATGTC 0: 1
1: 0
2: 2
3: 11
4: 183
Right 1137715437 16:50595527-50595549 GGGGCATGTCCTGAGAGCCCTGG 0: 1
1: 0
2: 4
3: 25
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137715434 Original CRISPR GACATGCCCCTGGGTGTTCC TGG (reversed) Intronic
900178784 1:1302390-1302412 GCCCAGCCCCTGGGTGCTCCCGG - Intronic
901693694 1:10990912-10990934 GACCTGCCCTTGGGGGTTGCAGG - Intergenic
904670377 1:32160414-32160436 GACCTATCCCTGGGAGTTCCTGG - Intronic
905245251 1:36608439-36608461 GACATTCTCCTGGGTGGGCCTGG + Intergenic
905768755 1:40624120-40624142 GGCCTGCCACTGGGGGTTCCAGG - Exonic
911084544 1:93965537-93965559 CAGATGACCCTGGGTGGTCCAGG + Intergenic
915361311 1:155287876-155287898 GACATGGCTCGGGGTGTTCGGGG + Exonic
918116027 1:181498459-181498481 AAGATGTCCCTGGGTGTGCCAGG + Intronic
918480612 1:184973894-184973916 GAGATACCCCTGGGGATTCCCGG - Intronic
918794048 1:188869655-188869677 GACAGGCCTCAGGATGTTCCTGG + Intergenic
920723988 1:208416471-208416493 GACAAGCCCATGGGTCTTCCAGG - Intergenic
922621998 1:226995721-226995743 GAGATTCCCCAGGGTGTTCTGGG - Intronic
923338885 1:232991448-232991470 GGGATGCGCGTGGGTGTTCCGGG + Intronic
923727925 1:236523611-236523633 GACGTCCACCTGGCTGTTCCAGG - Exonic
1063187843 10:3666506-3666528 GCCACGCCTCTGGCTGTTCCAGG + Intergenic
1067840203 10:49669676-49669698 GGCATGCCTCTGGGAGGTCCTGG - Intergenic
1069589131 10:69630975-69630997 CTCATCTCCCTGGGTGTTCCTGG + Intronic
1070609360 10:77922937-77922959 GACATGTGCCTGGGTGTTGGTGG - Intronic
1071302158 10:84264031-84264053 GAAGTGGCACTGGGTGTTCCTGG - Intergenic
1073008968 10:100345813-100345835 GACAAGCACCTGGGATTTCCTGG - Intergenic
1073443267 10:103565164-103565186 GACCTGCCCCTCCCTGTTCCTGG - Intronic
1075292620 10:121243224-121243246 AACATGTCCGTGAGTGTTCCCGG - Intergenic
1076280469 10:129242300-129242322 GGCATGCCGCTAGCTGTTCCTGG - Intergenic
1076903754 10:133352268-133352290 GACATGGCCCAGGGTGTCCTCGG - Exonic
1078851192 11:15165607-15165629 GGCATGCCACTGGGTCTTCTAGG - Intronic
1081187862 11:40066839-40066861 TAGATGCCCCAGGCTGTTCCTGG + Intergenic
1081670695 11:44940837-44940859 GCCATGCCACTGCGTGTCCCTGG + Intronic
1083652793 11:64212975-64212997 CACATGACCCTGGGAGGTCCAGG - Intronic
1084194270 11:67515312-67515334 CACTTGTCCCTGGGTGTTCAAGG - Intergenic
1084972753 11:72780711-72780733 TGCATGCCCCTGCCTGTTCCAGG - Intronic
1085711135 11:78830187-78830209 GAAATGCCCCGGGGGGTTCTAGG - Intronic
1093783282 12:23162046-23162068 GAGATGGGCCTGGGTGTTTCAGG - Intergenic
1095539411 12:43291118-43291140 CACATGCCTTTGGGTGTTCGTGG + Intergenic
1095825594 12:46527401-46527423 AAAATGCCTTTGGGTGTTCCTGG + Intergenic
1097324006 12:58255459-58255481 GACATGGCCATGGGTGTTTCAGG - Intergenic
1100325986 12:93540290-93540312 GATATTACCCTGGGTTTTCCAGG + Intergenic
1101233717 12:102767263-102767285 GACATTACCCTGTGTGTTGCGGG - Intergenic
1101835425 12:108291782-108291804 GACATATCCTTGGGTGTCCCTGG + Exonic
1103033729 12:117639791-117639813 GAAATGCCCCTTGATCTTCCTGG - Intronic
1103408574 12:120694007-120694029 GAAATGCCTCTGGCTGTTCTGGG + Intronic
1103476438 12:121222259-121222281 CACATGACCCTGGGTGAGCCAGG + Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104764112 12:131315392-131315414 CACCTGCCCCTGGGTGTCCTTGG - Intergenic
1107087454 13:36441344-36441366 AACATGCCACTGAGTCTTCCAGG + Intronic
1107295249 13:38900889-38900911 GTCAGGCCCCTGGCTGTTTCGGG + Intergenic
1113841879 13:113365175-113365197 GACCTTCCCATGGGTGTTTCCGG + Intergenic
1114484650 14:23055619-23055641 GAGCAGGCCCTGGGTGTTCCCGG + Exonic
1119828763 14:77681921-77681943 GGCATGCACCTGGTTTTTCCTGG + Intronic
1121121059 14:91376212-91376234 GACGAGCACCTGGGTGTTTCAGG - Intronic
1121450949 14:94007815-94007837 GACCTGCCCCTCAGGGTTCCTGG - Intergenic
1122517542 14:102319480-102319502 GACCTCCCCCTGGGAGATCCGGG + Intronic
1122793111 14:104192756-104192778 GCCCTGCCCCTGTGTGTACCTGG + Intergenic
1123042101 14:105494494-105494516 GCCGTGCCCCCGGGTGGTCCGGG - Intronic
1123403839 15:20009248-20009270 GACATGGCCCTGGTATTTCCAGG - Intergenic
1123513178 15:21015894-21015916 GACATGGCCCTGGTATTTCCAGG - Intergenic
1124626185 15:31308717-31308739 GAGATGTCCCAGGGTTTTCCTGG - Intergenic
1125008126 15:34840646-34840668 GACCTGGCCCAGGGTGTTCAAGG - Intergenic
1125775159 15:42206218-42206240 GACCTGCCTCTGGAAGTTCCTGG + Intronic
1127578714 15:60317195-60317217 GACATGCCCCAGGGTGTTGCAGG - Intergenic
1127656046 15:61057100-61057122 GAGATACCCTTGGGTGTTCAGGG - Intronic
1128419244 15:67475854-67475876 GACATGCCTGTGGGTGATCTAGG + Intronic
1128459112 15:67852772-67852794 GAGCTGCCCCTGGGTGACCCAGG + Intergenic
1129963411 15:79710516-79710538 GATGTGCCCCTGGATGTGCCAGG - Intergenic
1130894510 15:88159795-88159817 GACGTGCCCCTGGCTGGTCCAGG + Intronic
1133008281 16:2896642-2896664 GTCATGTCCCTGGGGGTGCCCGG + Exonic
1133851220 16:9505664-9505686 GACATCCCCCTTGCTGTTCTTGG - Intergenic
1134338194 16:13320652-13320674 GACATGGCTCTGCATGTTCCAGG - Intergenic
1134482197 16:14629846-14629868 GACAAGCCCCGGGGGGTGCCCGG + Intronic
1137341609 16:47612847-47612869 GGCATGCCCATGTCTGTTCCCGG + Intronic
1137715434 16:50595514-50595536 GACATGCCCCTGGGTGTTCCTGG - Intronic
1140194819 16:72847490-72847512 GTCAGGCCCCGGAGTGTTCCAGG + Intronic
1141131864 16:81442994-81443016 GACATCCCCCTTTCTGTTCCTGG + Intergenic
1141715674 16:85725401-85725423 GTGATTCCCCTGGGTGGTCCAGG - Intronic
1141921696 16:87139793-87139815 GAGATTCCCCTGGGTTATCCAGG + Intronic
1142075536 16:88115579-88115601 GCCAGGGCCCTGTGTGTTCCTGG + Intronic
1145220861 17:21087355-21087377 GCCATGCCCCTTGGTGTCCCTGG + Intergenic
1148094406 17:45042418-45042440 GACCCGCCCCTGCGTGTGCCAGG + Intronic
1148964540 17:51423623-51423645 GAGATGCCCGTGAGTGTTCCAGG + Intergenic
1150636906 17:66919424-66919446 TACACTCCCCTGGGTGTCCCAGG + Intergenic
1151317786 17:73334760-73334782 CGCATGCCCATGGGTGTCCCTGG + Exonic
1151809529 17:76429775-76429797 GCCATGCCCCTGCCTGCTCCTGG - Intronic
1152715577 17:81898991-81899013 GACCTGCCCGTGGGGGTTTCTGG - Intronic
1159939530 18:74396121-74396143 GACATGCTCCAGGTTGGTCCTGG - Intergenic
1161132689 19:2600826-2600848 GACCAACCCCTGGGTGTCCCTGG + Intronic
1161468395 19:4444611-4444633 GAGATGATCCTGGGTGGTCCGGG - Intronic
1161628512 19:5340027-5340049 GACAGGGCCCGGAGTGTTCCAGG + Intronic
1164706710 19:30325311-30325333 GACATGCCACTGAGGCTTCCAGG - Intronic
1166533873 19:43559735-43559757 GAGATGCCCCTGGATTATCCGGG + Intronic
1166982437 19:46639258-46639280 GGCGTGCCCCTCGGTGTACCTGG + Intergenic
1168076068 19:53981605-53981627 GACACGGCCCTGGATGGTCCAGG - Intronic
1168097395 19:54123545-54123567 GACATACCCCTGGGTGGTGGAGG - Exonic
1168169170 19:54574887-54574909 CCCATGCCCGTGGGTGGTCCTGG + Exonic
1168470409 19:56636125-56636147 GACCTGCCCCAGGGTGTCCGAGG + Intergenic
926843479 2:17107810-17107832 GAGATGCCCCTGGGGTATCCAGG + Intergenic
927267132 2:21163250-21163272 GACATGGCCCCGGGTGGTCCTGG + Intergenic
928349434 2:30535360-30535382 GACATGCACCTGGGGCTTGCTGG + Intronic
929967628 2:46547558-46547580 GCCAAGCCCATGGGTGGTCCAGG + Intronic
931375579 2:61704825-61704847 GAAATGACCCTGGATCTTCCAGG - Intergenic
932653818 2:73589749-73589771 GACAGGAACCTGGGTGCTCCTGG - Intronic
932835267 2:75030315-75030337 TACATGGCCCTGGGTCTTCATGG + Intergenic
934662198 2:96148952-96148974 GCCCTGCTCCTGGGTGGTCCTGG - Intergenic
935627735 2:105185195-105185217 GAAATGCTCCTGGCTCTTCCAGG + Intergenic
935850687 2:107215874-107215896 GCCATGCTCCTGGGGGTTGCTGG - Intergenic
936481280 2:112887208-112887230 GACTTGTACCTGGGTGTTCATGG - Intergenic
939953972 2:148509545-148509567 GAAATGCCGGTGCGTGTTCCGGG - Intronic
942666734 2:178327657-178327679 CACATGCCCCTGGGAGCCCCTGG - Intronic
946095725 2:217272762-217272784 AACATGCCTCTGGGTTTTCATGG - Intergenic
948992818 2:241563384-241563406 GAGCTGCCCCTGGGTGTGGCAGG + Intronic
1170503927 20:17004315-17004337 CACATCCCCCTGGTTGTTTCAGG + Intergenic
1170756202 20:19209503-19209525 GAAAGACCCCTGGGTGTTCATGG - Intergenic
1171020842 20:21582842-21582864 CACATGCCCCTGGGGTCTCCAGG + Intergenic
1172241096 20:33412871-33412893 GACATCCCCCTGGTTTCTCCTGG - Intronic
1172973636 20:38890893-38890915 GACCTGCCCCTGGGGCTTACGGG - Intronic
1174806501 20:53608389-53608411 GACCTGCCCTTCAGTGTTCCTGG + Intronic
1175716341 20:61256628-61256650 CACATGCCCCTGGGTGAATCTGG + Intronic
1176402063 21:6322832-6322854 GGTATGCCTTTGGGTGTTCCAGG - Intergenic
1176435094 21:6666272-6666294 GGTATGCCTTTGGGTGTTCCAGG + Intergenic
1176459356 21:6993342-6993364 GGTATGCCTTTGGGTGTTCCAGG + Intergenic
1178719743 21:34997982-34998004 GAGATGGCCCTGGATGTGCCAGG - Intronic
1179010927 21:37555548-37555570 GACAGGCCCCTGGGGGCTTCAGG - Intergenic
1179514925 21:41899723-41899745 GAAATGGCCGTGGGTGTTTCGGG + Intronic
1180732753 22:17994291-17994313 GCCATTCCCCTGGGGGCTCCAGG + Intronic
1181438668 22:22924646-22924668 GAAATGCTCCTGGGTTATCCAGG - Intergenic
1182344147 22:29648533-29648555 GACACACCGCTGGCTGTTCCAGG + Intronic
1182924614 22:34110562-34110584 GAGATGACTCTGGGTGATCCAGG - Intergenic
1185204634 22:49530808-49530830 CAGATGCCCCTGGCAGTTCCTGG + Intronic
1185376085 22:50483216-50483238 GACATGGCCCCGTGTGTTCAGGG - Exonic
950832709 3:15891063-15891085 AATATGCACCTAGGTGTTCCAGG - Intergenic
952179026 3:30898366-30898388 GATATGCCACTTGGTGTTACAGG + Intergenic
954633651 3:52059876-52059898 GACTTGCCCCTGGGCGTTCCGGG - Intergenic
954814488 3:53270074-53270096 GACATGACCCTGCTTGTCCCTGG + Intergenic
961903074 3:130233558-130233580 TTCATACCCCTGAGTGTTCCTGG + Intergenic
965495503 3:169393269-169393291 GCCATGCCACTGGAGGTTCCAGG - Intronic
967014554 3:185469986-185470008 TACAAGCCCTTGGGTGTTCCAGG - Intronic
967280045 3:187813426-187813448 GAGCTGCCCATGGTTGTTCCTGG - Intergenic
967530874 3:190547900-190547922 GAGGAGCCCCTGGGTGTTGCAGG + Intronic
967752226 3:193127929-193127951 GTCATGCACCTGGGAGTTCAAGG - Intergenic
968661350 4:1800054-1800076 CACAGGGCCCTGGGGGTTCCAGG + Intronic
969921509 4:10544773-10544795 CACATGCCCCTCTTTGTTCCTGG - Intronic
971788255 4:31133498-31133520 TATATGCCCCTGTCTGTTCCTGG + Intronic
975241868 4:72068596-72068618 GACATGCCACTGTCTGTTCTAGG - Intronic
979519163 4:121646229-121646251 AAGATGCCTCTAGGTGTTCCAGG - Intergenic
980101243 4:128543467-128543489 CACATGCACCTAGATGTTCCTGG - Intergenic
980107348 4:128600467-128600489 TACTTGCCCCTTTGTGTTCCTGG - Intergenic
985341643 4:188960960-188960982 GAGATGTCCCTTGGTGCTCCTGG + Intergenic
985540429 5:484965-484987 GACATGGTCCTGGGGGTTCCTGG - Intronic
986735257 5:10663332-10663354 AAGATGACCCTGGGTGGTCCTGG - Intergenic
991608262 5:68424792-68424814 CACATGAGCCTGGGTGTTCAAGG - Intergenic
992752210 5:79872040-79872062 CACATGCCCCTGGGGCCTCCCGG - Intergenic
993523421 5:88934153-88934175 GCCAGGCCACTGGGTGTGCCAGG + Intergenic
1000035665 5:157445773-157445795 GAGAGGGCCCTGGGTTTTCCAGG - Intronic
1003082348 6:3031648-3031670 GACATGCCCTTGAGTGTTCAGGG - Intergenic
1003241325 6:4348019-4348041 GACATGCCCCTGGGACATCTGGG - Intergenic
1004426433 6:15510282-15510304 GCCCTGCCCCTGGGTGTCTCAGG - Intronic
1006593000 6:35171846-35171868 CACATCCACCTGAGTGTTCCAGG + Intergenic
1016350887 6:143165973-143165995 AATATGTCCCAGGGTGTTCCTGG + Intronic
1016817401 6:148315938-148315960 GAAATGCCCATGGGTGTGGCAGG - Intronic
1018857309 6:167683924-167683946 GACCTGCCCCTTGGAGCTCCAGG - Intergenic
1019037331 6:169072610-169072632 GGCAGGACCCTGGGTGGTCCGGG - Intergenic
1019776641 7:2915478-2915500 GCTCTGCCCCTGGGGGTTCCTGG + Intronic
1020462442 7:8440838-8440860 GACAAGCACCTTGGTATTCCAGG - Intronic
1029551637 7:101239852-101239874 GGCATGGCCCTGGGTGTGGCGGG - Exonic
1032797143 7:135287122-135287144 GCCATGGCCCTAGGTGTTTCAGG + Intergenic
1033126858 7:138714160-138714182 GACATGAGCCTGGGAGTTCGAGG + Intronic
1033955900 7:146848095-146848117 GACAAGCTCCTGGATGTTCCTGG - Intronic
1034442955 7:151096367-151096389 AAGATGACCCTGGGTGTTCACGG - Intronic
1035442878 7:158918101-158918123 GTCCTGACCCTGAGTGTTCCCGG + Intronic
1040071854 8:43195166-43195188 CCCATGCCCCGAGGTGTTCCAGG - Intronic
1040871080 8:52100700-52100722 GACGTGCCCCTCAGTGTGCCAGG + Intergenic
1044712537 8:95071824-95071846 GAGATGCCCCTGGGCGCTGCTGG - Intronic
1049227821 8:141466130-141466152 CACAGGACCCTGGGTGCTCCTGG - Intergenic
1049407178 8:142456978-142457000 GACCGGCCCCGGGGTGTGCCTGG + Intronic
1049638175 8:143700504-143700526 GACGTGAGCCTGGGTGTTCTGGG - Intronic
1053072223 9:35108127-35108149 GACATCCCCCGGGGTCTACCAGG - Exonic
1055987044 9:82062939-82062961 GGCCTGAGCCTGGGTGTTCCTGG - Intergenic
1056583857 9:87915215-87915237 GGCCTGAGCCTGGGTGTTCCTGG + Intergenic
1056584349 9:87918684-87918706 GGCCTGAGCCTGGGTGTTCCTGG + Intergenic
1056612520 9:88134238-88134260 GGCCTGAGCCTGGGTGTTCCTGG - Intergenic
1056613012 9:88137706-88137728 GGCCTGAGCCTGGGTGTTCCTGG - Intergenic
1056664608 9:88571767-88571789 GAGATGCCCCCAGGTGTTCAAGG - Intronic
1056792476 9:89634927-89634949 GACAAAGCCCAGGGTGTTCCTGG + Intergenic
1057160137 9:92883299-92883321 GGCCTGAGCCTGGGTGTTCCAGG + Intergenic
1061039669 9:128132705-128132727 GTCATGCCCCTGACTATTCCCGG - Intergenic
1061922724 9:133791039-133791061 GACCTGCCCCTGTGCGTTACAGG - Intronic
1062058208 9:134480146-134480168 GGCATGCCCCAGACTGTTCCGGG - Intergenic
1203436442 Un_GL000195v1:142375-142397 GGTATGCCTTTGGGTGTTCCAGG - Intergenic
1185882575 X:3754692-3754714 GAGATGCCCCTGGATGACCCAGG + Intergenic
1186503491 X:10071366-10071388 GAGATGCCAGTGGGTCTTCCTGG + Intronic
1187302125 X:18060864-18060886 TACATCCCTCTTGGTGTTCCAGG + Intergenic
1189160606 X:38805064-38805086 GACGTGCCCCTGGCTGACCCCGG + Exonic
1189883599 X:45516615-45516637 GGCAAGCCCCTAGGTGTTTCAGG + Intergenic
1196535135 X:116835573-116835595 GACATACCCATCTGTGTTCCTGG + Intergenic
1198935859 X:141902739-141902761 AACATGCCCCTGGGCCTCCCAGG - Intergenic
1199679243 X:150214206-150214228 GACAAGCCCATGGGTCGTCCTGG + Intergenic
1200164729 X:154028205-154028227 GACATGCCTGTGGGTGTTTCTGG + Intronic
1200222424 X:154397721-154397743 GAGATGCCCCGGGGTTTCCCAGG + Intronic
1200782418 Y:7228622-7228644 GAGATGCCCCTGGATGACCCAGG - Intergenic