ID: 1137715856

View in Genome Browser
Species Human (GRCh38)
Location 16:50597976-50597998
Sequence CACTGGCAGTAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137715850_1137715856 -3 Left 1137715850 16:50597956-50597978 CCGGAGGAGGCAAAAGACTTCAC 0: 1
1: 0
2: 0
3: 13
4: 237
Right 1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG 0: 1
1: 1
2: 2
3: 45
4: 438
1137715849_1137715856 8 Left 1137715849 16:50597945-50597967 CCACAGTGGCTCCGGAGGAGGCA 0: 1
1: 0
2: 0
3: 22
4: 228
Right 1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG 0: 1
1: 1
2: 2
3: 45
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137715856 Original CRISPR CACTGGCAGTAGAGGGAGGA GGG Intronic
900122321 1:1054103-1054125 CACTGCCAGTGGGAGGAGGAAGG + Intronic
900391723 1:2436591-2436613 CACTGACCTTGGAGGGAGGAAGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900708276 1:4094208-4094230 CACTGGAAGTCAAGGGAAGATGG + Intergenic
901496962 1:9627794-9627816 CAAAGGCAGTAGAGAGAGGAGGG + Intergenic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
902076908 1:13794276-13794298 CACAGCAAGTAGAGGGATGAGGG - Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
904708617 1:32411462-32411484 CTCTGGCAGTACAGGGCAGATGG - Intergenic
904708823 1:32413105-32413127 GGCTGGCAGAAAAGGGAGGATGG - Intergenic
904849674 1:33447861-33447883 CACTGGCAGGAGTTGGAGGGTGG - Intergenic
905649625 1:39647564-39647586 CAGTGGCAGAATAGGGAGGTCGG - Intergenic
905964460 1:42080680-42080702 CACTGGCTGTACAGGAAGCATGG + Intergenic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906346713 1:45020035-45020057 CCCTGGGGGTAGAGGGAGGTGGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907933310 1:59019790-59019812 GAGTGGCAGGAGAGTGAGGATGG + Intergenic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
909659290 1:78064380-78064402 CACTGGCATTTGAGGGAAGCAGG - Intronic
910365117 1:86456903-86456925 TAATAGCAATAGAGGGAGGAAGG - Intergenic
910766172 1:90784624-90784646 CATTAGCATTAGAGGGAGGGAGG + Intergenic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
911721783 1:101198986-101199008 AACTGGCAGTCGGGAGAGGAGGG - Intergenic
912067403 1:105761235-105761257 CACTGACAGTGGAGGAAAGAAGG + Intergenic
912183303 1:107244658-107244680 AGCTGGCAGGAGAAGGAGGAAGG - Intronic
912421119 1:109543088-109543110 CACTGGCAGTAGAGGGACCTGGG - Exonic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
914490471 1:148147833-148147855 CCCAGGCAGTAGAGACAGGAGGG - Intronic
914905480 1:151740186-151740208 CACTGGCAGTAGGTGGAGCATGG + Intergenic
915003088 1:152611494-152611516 CATTGGCAGCTGAGGGAGGTAGG - Intergenic
915529133 1:156493422-156493444 CCCTGGCAGCGGAGGGAGGGCGG + Intronic
915834474 1:159164222-159164244 CTCTGGCAGTAGTGGATGGATGG - Intergenic
916003069 1:160634896-160634918 CTCTGTCAGGAGTGGGAGGAAGG + Exonic
916020652 1:160789320-160789342 GGCTGGCAGGAGAGGGAGGAAGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
917736809 1:177928985-177929007 CACTGGAGTGAGAGGGAGGAGGG - Intronic
918134480 1:181659282-181659304 CACAGGCATTGGTGGGAGGAAGG + Intronic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920815864 1:209331367-209331389 TTCTGCCAGAAGAGGGAGGAAGG + Intergenic
920971343 1:210745912-210745934 CCCTGGCACTAGAGGGGGGGTGG + Intronic
921390059 1:214607384-214607406 CCCAGGCAGTAGAGACAGGAGGG + Intronic
923044985 1:230349167-230349189 CACTAACTGTAGAGGGAGAAGGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
1063030284 10:2227757-2227779 CACTGGCAGTGGTAGGAGGAAGG + Intergenic
1065323006 10:24526156-24526178 GACTTTCAGTAGAGGCAGGAGGG - Intronic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1067335210 10:45356048-45356070 TAGTGGCAGTAGAGGCAGTAGGG + Intergenic
1067467940 10:46515144-46515166 CAATGCCAGTTGAGGGAGGAAGG - Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1069937122 10:71925238-71925260 CACTGGCAGAAGATGGAAGCAGG - Intergenic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1072266220 10:93730478-93730500 CACTGGCAGATGAGGGTAGAGGG - Intergenic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072711299 10:97717316-97717338 CACTGGCAGTAGGGGGAGATGGG + Exonic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073429402 10:103476548-103476570 ACCTGGCAGCAGAGGAAGGAGGG + Exonic
1074538431 10:114345424-114345446 GACTGGCAGTGGAGGCAGGGAGG + Intronic
1074962615 10:118461726-118461748 CACTGGCAGTAGAGACTGGTAGG + Intergenic
1075045142 10:119140625-119140647 CGCTGGCATTACACGGAGGAAGG + Intergenic
1075236753 10:120737425-120737447 CACGGGCAGCAGAGGTGGGATGG - Intergenic
1075345972 10:121682081-121682103 TACTGCCAGGAGAGGGAGGGGGG + Intergenic
1076168996 10:128304605-128304627 CACCAGCAGTGGATGGAGGAGGG - Intergenic
1076738773 10:132470701-132470723 AACTGGCAGGAGATGGAGGTGGG - Intergenic
1076757478 10:132580014-132580036 CCCTGCCAGCAGTGGGAGGAAGG - Intronic
1076805021 10:132851181-132851203 CACGGGCAGCAGAGTGAGCAGGG - Exonic
1077077128 11:706874-706896 CCCTGCCAGGAGAGGCAGGAGGG + Intronic
1077303792 11:1858864-1858886 CACAGGCAGACAAGGGAGGAGGG + Intronic
1077411429 11:2405662-2405684 CCCTGGCAGGAGAGGGGAGATGG - Intronic
1077838317 11:5944928-5944950 TGCTGTCAGTGGAGGGAGGACGG - Intergenic
1079675126 11:23217316-23217338 CACAGGCAGGAGAGGCAGCAGGG + Intergenic
1080739111 11:35047378-35047400 CACAGACAGAAGAGGGAGCAAGG - Intergenic
1081024804 11:37998153-37998175 CACAGGCTGTACAGGGAGCATGG + Intergenic
1081181958 11:39994727-39994749 CTCTGGCAATATTGGGAGGAAGG + Intergenic
1081485647 11:43525872-43525894 CACAGGCCGTACAGGAAGGATGG - Intergenic
1082959145 11:58902333-58902355 CAATGGCAGAAGTGGCAGGAAGG - Intronic
1083244469 11:61415750-61415772 CACTCACTGTAGAGGGTGGAGGG + Exonic
1083624322 11:64064368-64064390 CACAGGCATTGGATGGAGGATGG + Intronic
1084320195 11:68369284-68369306 CACTGGAGTTAGAGGGAGCAGGG + Intronic
1085242638 11:75071436-75071458 CACCAGCAGAAGGGGGAGGAAGG + Intergenic
1085398240 11:76218549-76218571 CACTGGCTTGAGAGGGAGGCTGG + Intergenic
1085405861 11:76261785-76261807 ACCTGGAGGTAGAGGGAGGAAGG + Intergenic
1087145436 11:94806107-94806129 CACTGACAGTGCAGGGAGGAGGG + Intronic
1087194305 11:95289882-95289904 CACTGGAGGTAGAGGGAGCAGGG - Intergenic
1087828082 11:102788967-102788989 CACCGGCTGTACAGGGAGCATGG - Intergenic
1088305596 11:108404219-108404241 CACTTGCAGTACAGAGGGGAAGG - Intronic
1088308314 11:108433799-108433821 CACTTGCAGTACAGAGAGGAAGG + Intronic
1089177846 11:116561213-116561235 CCCTGGAGGTAGAGGGAGGATGG - Intergenic
1089772275 11:120812114-120812136 CCATGGCAGTAGACGTAGGAAGG + Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1091051106 11:132373553-132373575 CACTGCCAGGAGATGGGGGAGGG - Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1092283355 12:7114017-7114039 TACTGGCAGAGTAGGGAGGATGG - Intergenic
1092561970 12:9625155-9625177 GACTGGTAGTAGAGTGTGGAAGG - Intergenic
1095292612 12:40492814-40492836 CACTGCCATAGGAGGGAGGATGG - Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096154601 12:49334986-49335008 CACAGGCTGCAGAGGGAGGTTGG - Intronic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1097197427 12:57251016-57251038 CACAGGCTGTAGAGGGAGCTGGG + Exonic
1097916061 12:65021562-65021584 CGCTGGCAGTGGGAGGAGGAGGG - Intergenic
1100216769 12:92458495-92458517 CACAGGCTGTACAGGGAGCATGG + Intergenic
1101162691 12:101994931-101994953 CACTGGCTGTAGGGGTAGAAAGG - Intronic
1101627521 12:106460142-106460164 CGCTGGCACAAGAGGCAGGATGG - Intronic
1102574153 12:113845263-113845285 CACTGGCAGCAGAGACAGAAGGG - Intronic
1102720782 12:115014136-115014158 GACTGGGAGTAAAGGGAGGGAGG + Intergenic
1102746061 12:115250145-115250167 CCCTTGCAGGATAGGGAGGAAGG + Intergenic
1102769755 12:115465159-115465181 AACAGGTAGTAGAGGGAGGTGGG + Intergenic
1104376979 12:128272185-128272207 GACTGGAGGTAGAGGAAGGAGGG - Intronic
1104656392 12:130576654-130576676 AGCTGGCAGGACAGGGAGGACGG + Intronic
1105432176 13:20346339-20346361 CGAGGGCAGTAGAGGCAGGAAGG - Intergenic
1107164125 13:37265479-37265501 CACAGGCTGTGGAGGGAGCATGG - Intergenic
1107838066 13:44428157-44428179 CACTGGCAGGAGATGGAAGTGGG - Intergenic
1108884698 13:55165496-55165518 CACTGGCAGTGGCAGGAGTATGG - Intergenic
1109866795 13:68274875-68274897 CACAGGCTGTAGAGGAAGCATGG + Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1114679884 14:24475427-24475449 CACTGGCAGGAGGTGGAGGCAGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115875081 14:37852396-37852418 AAATGGCAGTAGAGAGAGGCAGG + Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1117994966 14:61469810-61469832 CACTGGCAGGTTAGGGGGGAAGG + Intronic
1118224469 14:63886001-63886023 TACTGGCAAAAGAGGGAGGGAGG - Intronic
1119634650 14:76264124-76264146 GACAGGCAGAGGAGGGAGGATGG + Intergenic
1120143986 14:80959221-80959243 CACTGGCAGTGGGGGAAGTAGGG - Intronic
1120275584 14:82369542-82369564 CACTGCCAGTGGAGGAAGGAGGG - Intergenic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1122544164 14:102513083-102513105 CACAGGCAGTAGGGGGAGGCTGG + Intergenic
1123978117 15:25571927-25571949 GACTGGTATTAGAGGAAGGATGG - Intergenic
1125439164 15:39683045-39683067 CACTGGCAGTAAAGGCATGTTGG + Intronic
1125890166 15:43260005-43260027 CACTGACAGAAGAGAAAGGAGGG + Intronic
1126316189 15:47372528-47372550 CATTTGCAGCAGAGGCAGGAAGG - Intronic
1126790033 15:52212518-52212540 CACTCGCAGAAGAGGAAGGAAGG + Intronic
1127405381 15:58638854-58638876 AACTGTCAGGGGAGGGAGGAAGG + Intronic
1128091567 15:64922409-64922431 CACTGGGATTTGAGGGAGCAGGG + Intronic
1128516381 15:68344511-68344533 CACAGGCTGAAGAGGCAGGAGGG + Intronic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129533105 15:76285411-76285433 CACTGGCACCAGGGGGAGCATGG - Intronic
1129597130 15:76973928-76973950 CACAGTAAGTAGTGGGAGGATGG + Intergenic
1130197787 15:81796992-81797014 CATTTGCAGTAGAGAGATGAGGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131826333 15:96324617-96324639 AACTGGCAGGAAAGGGAGAAGGG + Intergenic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1133642849 16:7734608-7734630 CACAGGCTGTACAGGGAGCATGG + Intergenic
1133684726 16:8155264-8155286 CACTGTCAGAGGTGGGAGGAAGG - Intergenic
1134605009 16:15563596-15563618 CACTGGCTGTACAGGAAGCATGG + Intronic
1135309206 16:21392120-21392142 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136024856 16:27462745-27462767 CATTGGCAGGAGAGGGACAAGGG + Intronic
1136148787 16:28332447-28332469 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136305949 16:29371250-29371272 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136368712 16:29822231-29822253 AATTGGCAGGAGTGGGAGGAGGG + Intronic
1136445119 16:30312489-30312511 CACTGGTAGTGGTGGGAGAAGGG - Intergenic
1136707295 16:32201002-32201024 CCCGGGCAGTAGAGACAGGAGGG - Intergenic
1136760616 16:32728415-32728437 CCCGGGCAGTAGAGACAGGAGGG + Intergenic
1136807487 16:33141971-33141993 CCCGGGCAGTAGAGACAGGAGGG - Intergenic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138299035 16:55911044-55911066 CACTGGCAGATGAGTGGGGAGGG - Intronic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138493578 16:57393063-57393085 AACTGGCAGTAGGAGGATGAGGG - Intergenic
1138897009 16:61218843-61218865 CACTGGCAGAAGCTGGAGGGAGG - Intergenic
1139310364 16:66023376-66023398 CACAGGCAGCCGAGGGAGGAAGG + Intergenic
1139468530 16:67166480-67166502 CACTTCCAGGTGAGGGAGGAAGG - Intronic
1140083595 16:71774303-71774325 GACTGGCAGTTGGGGGAGGACGG + Intronic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141010081 16:80388947-80388969 CACTGGCAGGTTAGGGATGAGGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141675632 16:85515841-85515863 CCTTGGCAGAAGAGGCAGGAGGG - Intergenic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1203062768 16_KI270728v1_random:988730-988752 CCCGGGCAGTAGAGACAGGAGGG + Intergenic
1144010726 17:11146342-11146364 CACAAGGAGTAGAGGAAGGAAGG - Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144930603 17:18855977-18855999 CACTGGCTTCAGAGGGTGGAGGG + Intronic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145191062 17:20842435-20842457 CCCAGGCAGTAGAGACAGGAGGG - Intronic
1145989346 17:29069563-29069585 CCCTGTCAGTAGTGAGAGGAGGG - Intergenic
1145992278 17:29086296-29086318 ATCTGGCAGTAAAGGGAGGGTGG + Intronic
1146376149 17:32295893-32295915 CACAGGTAGTATAGGGAGGAAGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147332474 17:39706969-39706991 CACTGGCAGGAGAGAGCAGATGG - Exonic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1148780031 17:50116135-50116157 CACTGGCAGCCGAAGGAGGCAGG - Intronic
1150006852 17:61475323-61475345 TACTGGCAGCAGTGGTAGGAGGG + Intronic
1150262721 17:63808866-63808888 CAGTGGCCGTATATGGAGGAGGG + Exonic
1150637462 17:66924231-66924253 TTCAGGCAATAGAGGGAGGATGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151210891 17:72543093-72543115 AACTGGCAAAAAAGGGAGGAAGG - Intergenic
1152641801 17:81452396-81452418 CAGTGGCAGAAGGGGGAGTAGGG + Intronic
1152677963 17:81651304-81651326 CACTGGCTGTGGGGGAAGGAGGG + Intronic
1153495737 18:5696944-5696966 GACTGGGAGTAGTGGGGGGATGG - Intergenic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1154230446 18:12551919-12551941 CACTGCCAGGAGGTGGAGGAGGG - Intronic
1155996301 18:32334444-32334466 CACAGGGAGTGGGGGGAGGATGG + Intronic
1156393993 18:36681486-36681508 CACTGGCAGCAGAGAGAGAGAGG + Exonic
1157257732 18:46153394-46153416 CACAGGCAGTGGAGGGAGAGGGG + Intergenic
1157488609 18:48107167-48107189 AACCGTCAGGAGAGGGAGGAAGG + Intronic
1158216367 18:55104433-55104455 CACTGGCTGTAAAGGAAGCATGG + Intergenic
1158541736 18:58362517-58362539 CGCTGGCAGGAGAGAGTGGAAGG + Intronic
1160699432 19:498753-498775 GCCTGGCAGTAGAGGGCGGGCGG - Exonic
1160995139 19:1878988-1879010 CCCAGGCAGTAGAGACAGGAGGG + Intronic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1161502294 19:4623003-4623025 CACGGGCAGCAGAGGGAGCGAGG - Intergenic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1162788489 19:13051050-13051072 ACTTGGCAGTGGAGGGAGGAGGG + Intronic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166791335 19:45400411-45400433 CTCTGGCAGTATAGGCAGCAGGG + Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1166952494 19:46438867-46438889 GCCTGGCAGCAGAGGGAGCAAGG + Intergenic
1166952689 19:46440281-46440303 GCCTGGCAGCAGAGGGAGCAAGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168255748 19:55164144-55164166 CACAGGCTGTACAGGGAGTATGG - Intronic
1168295455 19:55375418-55375440 CACCTGCATTAGAGGGAGAAGGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925130023 2:1488245-1488267 CGCTTCTAGTAGAGGGAGGAGGG + Intronic
925269293 2:2590978-2591000 CACTGCCAGGAGATGGGGGAGGG - Intergenic
925292783 2:2758867-2758889 CACTGGCAGAAGAGAGCAGAAGG + Intergenic
925385984 2:3461914-3461936 CACAGGCAGCACAGGGAGAATGG - Intronic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
925957567 2:8982610-8982632 CACTGGAAGTAGATGGATGGAGG - Intronic
925998085 2:9308177-9308199 CACAGGCTGTAGAGGAAGCATGG + Intronic
926639068 2:15215817-15215839 AACTAGTGGTAGAGGGAGGATGG + Intronic
927186723 2:20487405-20487427 CACTGGCAGTGCAGGGAAAAGGG + Intergenic
927408677 2:22800631-22800653 CACAGACAGCAGTGGGAGGAAGG + Intergenic
928404363 2:31003407-31003429 ACCTGGCTGTTGAGGGAGGAGGG - Intronic
929055925 2:37875833-37875855 GGCTGGCAGAGGAGGGAGGAGGG - Intergenic
929284277 2:40117809-40117831 CACTGGAAGTTTACGGAGGAAGG - Intronic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
931093939 2:58918564-58918586 CACCTGCAATAGAGGAAGGATGG + Intergenic
931249911 2:60521171-60521193 CACTGGCAGTAGACAATGGAAGG - Intronic
932344554 2:70987055-70987077 CACTGGCAGTAGAGTGGAGGGGG + Exonic
932435814 2:71702086-71702108 CCCTGGCAGGAGAGGAAGGCCGG + Intergenic
932476844 2:72011646-72011668 CACTGGCAGGAGAGGAGGAAGGG + Intergenic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933244245 2:79957388-79957410 CACCAGCAGGAGATGGAGGAGGG + Intronic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
934102168 2:88663619-88663641 CACTGGCTGGAATGGGAGGAGGG + Intergenic
934553369 2:95275382-95275404 CCCTGGCAGTGGGGAGAGGAGGG + Intronic
934884409 2:98012008-98012030 CACTGCTAATGGAGGGAGGAAGG + Intergenic
935580931 2:104755357-104755379 GGCTAGAAGTAGAGGGAGGAGGG + Intergenic
935713491 2:105919432-105919454 AGCTGTAAGTAGAGGGAGGATGG + Intergenic
936060619 2:109293476-109293498 CACTGGCAGTGGAGAGAGAAGGG - Intronic
936084274 2:109455907-109455929 CACTGGCATGAGAGGTAGAAGGG + Intronic
936260253 2:110953722-110953744 CACAGGCTGTAGAGGAAGCATGG + Intronic
936960210 2:118065454-118065476 CACTGGCAGAACATGGAGGGGGG - Intergenic
938938944 2:136152267-136152289 TTCTGGCAGTAGTGGGAGGGAGG - Intergenic
940961403 2:159790496-159790518 CTCTGGCAGCAGAGAGGGGAAGG - Intronic
942801672 2:179883069-179883091 CACTGGCAGAAGGGAGAGGGGGG + Intergenic
942970457 2:181951849-181951871 CAGTTGCAGAAGAGGGAGTAAGG - Intergenic
943010593 2:182443637-182443659 CACAGGCTGTAGAGGAAGCATGG - Intronic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
943400964 2:187410510-187410532 CACTGGCTGTTGAGAGAGAAGGG + Intronic
944507677 2:200429565-200429587 CACTGACAGTGGCGGGAGGTGGG + Intronic
944637210 2:201685982-201686004 GTCTGGCAGTGGAGGGAGAAGGG + Exonic
946025676 2:216670475-216670497 CACGGGCAGTACAGGGTGGTGGG + Intergenic
946058789 2:216923691-216923713 CATTGCCAGTAGGGGGAAGAAGG - Intergenic
946170371 2:217891796-217891818 CACTGAGAGAAGAGGAAGGATGG - Intronic
946303082 2:218836682-218836704 CCCAGGCAGTAGAGGGTGCAGGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947380806 2:229543687-229543709 CACTGGCAGGGGGTGGAGGAGGG - Intronic
948000124 2:234560739-234560761 CACTGGTGGGAGAGAGAGGAAGG + Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948736663 2:240012480-240012502 CACTTACAGGAGAGAGAGGAAGG + Intronic
1168779052 20:473273-473295 CATTGGCAGGTGGGGGAGGAGGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169427172 20:5505321-5505343 CACAGGCTGAAGAAGGAGGATGG - Intergenic
1172971007 20:38873039-38873061 CCCTGGCAGGAGAGGTGGGACGG - Intronic
1173060085 20:39652206-39652228 CGCTGGCAATGGAGGAAGGAGGG + Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174136358 20:48382766-48382788 CACTGGCTGCAGATGGAGAAAGG + Intergenic
1175502638 20:59461248-59461270 CACTGGCAGAACATGGTGGAGGG + Intergenic
1175592873 20:60207380-60207402 CACAGGCTGTAGAGGAAGCATGG + Intergenic
1175926470 20:62473962-62473984 CACTGGCAGGGGAGGGATGAAGG + Intronic
1175966399 20:62662057-62662079 CACTGGCCATAGTGGGTGGAGGG + Intronic
1177181974 21:17753940-17753962 TAATGGTAGTAGATGGAGGAAGG - Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178972452 21:37193141-37193163 GTCTGGCAGTAGTGGGAGGGTGG - Intronic
1179048176 21:37865447-37865469 CACTGGCTGGAGGGGGAGGCAGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1180946476 22:19696436-19696458 CACTGACAGTGGAGAGGGGATGG - Intergenic
1181121204 22:20669526-20669548 CCCAGGCAGTAGAGACAGGAGGG + Intergenic
1181334164 22:22116551-22116573 CCCAGGCAGTAGAGACAGGAGGG + Intergenic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183235413 22:36613334-36613356 CACTAGCACTTGAGGGAGAAAGG - Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1185144368 22:49122489-49122511 CACAGGCTGTACAGGGAGCATGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
950191545 3:10980174-10980196 AACTGGAAGTAGAGAGAGGAGGG + Intergenic
952258873 3:31720246-31720268 CTTTGGCAGTAGTAGGAGGAGGG - Intronic
954030977 3:47819781-47819803 CATTGGCAGTGGAGGAAGGGGGG - Intronic
954274907 3:49535817-49535839 CACAGGCAGAAGAGGGGTGAAGG - Intergenic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955638722 3:61058663-61058685 CACAGGCTGTAGAGGAAGCATGG - Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
956776373 3:72568630-72568652 GACAAGCAGCAGAGGGAGGAAGG - Intergenic
958748343 3:98164615-98164637 CACAGGCTGTAGAGGAAGCATGG + Intergenic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
960043920 3:113178195-113178217 CACTGGCATGAGTGGGAGGGAGG + Intergenic
960346465 3:116539119-116539141 CACTGGCAGTAGTGGGGTGGTGG - Intronic
960670285 3:120148922-120148944 CCCTTGCATGAGAGGGAGGAAGG - Intergenic
961635009 3:128327814-128327836 GCCTGGCAGTACATGGAGGAGGG + Intronic
961875061 3:130016089-130016111 CTCTTGCAGTTGAGAGAGGAAGG - Intergenic
962015024 3:131430886-131430908 CACTGCCAGGGGATGGAGGAGGG - Intergenic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
962464892 3:135649029-135649051 CAATGGCAGTAGTGAGGGGAGGG + Intergenic
963163405 3:142175686-142175708 TACTGGCAGTAGAGGGCAGTTGG - Intronic
963605017 3:147406156-147406178 CACTGACACTAAGGGGAGGAGGG - Intronic
963812341 3:149790402-149790424 TACTGGCAGTGGAATGAGGAAGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
967098529 3:186196902-186196924 CACAGGCTGGAGAGGGAAGATGG + Intronic
968239398 3:197062946-197062968 CAATGGCAGTAGTGGGAGTGAGG - Intronic
968582421 4:1401305-1401327 CTCTGCCAGCGGAGGGAGGAGGG + Intergenic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968707319 4:2086001-2086023 CACTGGCCGCACTGGGAGGAGGG - Intronic
972976806 4:44645053-44645075 CACAGGCTGTAGAGGAAGCATGG - Intronic
973670050 4:53207859-53207881 CACTGGCTGTACAGGAAGCATGG - Intronic
973786588 4:54338022-54338044 CTCTGGCACTTGATGGAGGAGGG + Intergenic
974220541 4:58964047-58964069 CACAGGCTGTACAGGGAGCATGG + Intergenic
976199419 4:82563634-82563656 GACAGGGAGTAGAGAGAGGAGGG - Intergenic
976711253 4:88073604-88073626 GACTGGAAGTTGGGGGAGGAGGG + Intronic
977102878 4:92840416-92840438 CACTTTCAGTAGAGGAAGAAGGG - Intronic
978922533 4:114201486-114201508 CAATGGCAGCATAGTGAGGAGGG - Intergenic
979276339 4:118818322-118818344 CAATGGCAGTAGGGGGCAGAAGG - Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
980383436 4:132057333-132057355 CACAGGCTGTAGAGGAAGCATGG - Intergenic
981649651 4:147041538-147041560 CACTTACAGAAGGGGGAGGATGG - Intergenic
981782739 4:148445091-148445113 CAGTGGCCGTAGTGGGAGGGCGG - Intergenic
982355086 4:154457773-154457795 AACTGGCAGTAGAAAGAGGCGGG - Intronic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
982926182 4:161339622-161339644 GACAGGAAGTAGAGGGAGAAAGG - Intergenic
985010095 4:185573545-185573567 ACCTGGCTGGAGAGGGAGGAAGG + Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985632650 5:1022038-1022060 GACTGGCGGTAGGGGGAGGGTGG - Intronic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986590637 5:9365810-9365832 GACAGGCAGTAGTGGGAGGGTGG - Intronic
986691980 5:10320788-10320810 CACAGGCTGTAGAGGAAGCATGG + Intergenic
988956475 5:36324746-36324768 CACTGCCAGGGGATGGAGGAGGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
993379474 5:87190050-87190072 CCCAGGCACTAGAGGTAGGATGG + Intergenic
994061019 5:95476468-95476490 AGCTGGCAGTATGGGGAGGATGG - Intronic
994185242 5:96808430-96808452 CACTGGCAGTGGCGAGATGACGG - Intergenic
996129523 5:119764894-119764916 TACTGGCAGGAGATGGAGGGTGG - Intergenic
996848261 5:127924652-127924674 ACCTGACAGTAGAGGCAGGATGG + Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997690743 5:135825974-135825996 CACTGACTGTCGAGGGATGAAGG + Intergenic
999090510 5:148931949-148931971 TAGTGGCAGAATAGGGAGGAAGG - Intronic
999749734 5:154618671-154618693 AGCTGACAGTAGAGGGAGAAAGG - Intergenic
1000024030 5:157343313-157343335 CACAGGAAGTAGAGAGTGGAAGG + Exonic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1001483487 5:172104139-172104161 CAGTGGCAGGAAGGGGAGGAAGG - Intronic
1001636164 5:173211801-173211823 CACTGGCTGTAGAGGCCAGAGGG + Intergenic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1002716528 5:181231535-181231557 CACTGGCTGGGAAGGGAGGAGGG - Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003578816 6:7320993-7321015 CACTGACAGCAGTGGGAGTAAGG + Intronic
1004335964 6:14764727-14764749 CACTGGCAGTGGGGGGGGAATGG - Intergenic
1004515353 6:16317744-16317766 TGCTGGCAGCAGTGGGAGGAGGG - Intronic
1005791558 6:29307817-29307839 CACTTGAATTGGAGGGAGGAAGG - Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006899181 6:37489304-37489326 GACTGGCAGTGCAGGGAGGAGGG + Intronic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1009055634 6:58331347-58331369 GACTGGCAGGAGAGGGAGAGAGG + Intergenic
1009235537 6:61119247-61119269 GACTGGCAGGAGAGGGAGAGAGG - Intergenic
1009375389 6:62961773-62961795 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012951645 6:105524245-105524267 AACTGGCAGTTAAGGGAGTAGGG + Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1014465200 6:121748535-121748557 GACTGGTAGTAGAGGAAGGGAGG + Intergenic
1015635447 6:135269916-135269938 CACTGGTGGTAGGGGGATGAAGG + Intergenic
1016054856 6:139567581-139567603 CACTGCCAGGGGATGGAGGAAGG + Intergenic
1018287298 6:162254671-162254693 CTCTGGCAGTGGATGAAGGATGG - Intronic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1018923804 6:168193344-168193366 GGCTGGCAGGAGCGGGAGGAAGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019118671 6:169786015-169786037 CACTGGCACTAGAGAGGGGCAGG - Intergenic
1019469247 7:1209637-1209659 GACAGGCAGAAGAGAGAGGAGGG - Intergenic
1019508346 7:1404786-1404808 GACTGGGAGGAGTGGGAGGAGGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019869430 7:3745393-3745415 CACTGGCAGAAGTGGGGTGAAGG - Intronic
1019944496 7:4315871-4315893 CACTGGCTGTACAGGAAGCATGG + Intergenic
1022111866 7:27236812-27236834 GACTGGGAGTAGGGGGAGCAAGG + Intergenic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1022822814 7:33977940-33977962 CTCTGGCAGAAGAGTGCGGAGGG + Intronic
1023485307 7:40680131-40680153 CTCAGGCAGAATAGGGAGGAAGG + Intronic
1026571704 7:71537015-71537037 CTCAGGCAGTAGAAGGATGATGG - Intronic
1028963617 7:96777033-96777055 CAGTGGCAGTAGCTGGTGGATGG + Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030736809 7:113058717-113058739 CACTGCAAGTAGAGTGGGGAGGG + Intergenic
1031303566 7:120095449-120095471 CAGTGGCAGTAGAGAGGGTAAGG - Intergenic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1033544971 7:142391596-142391618 CACGGGCAGTGGAGGGTGAAGGG + Intergenic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1035071577 7:156148779-156148801 TCCTGGCTGGAGAGGGAGGAGGG - Intergenic
1035280127 7:157773160-157773182 CACTCGCAGCAGACGGAGGCAGG + Intronic
1035325224 7:158061604-158061626 CACTGGCTGTGGACGGAGGAAGG + Intronic
1035468163 7:159093166-159093188 CACTGGCAGTTACTGGAGGAAGG + Intronic
1038408075 8:27336979-27337001 AACTGGCAGTGGCGGGGGGAGGG - Intronic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1040870269 8:52093510-52093532 CATTGGCAGTGGAGGCAGCAGGG - Intergenic
1041547464 8:59061840-59061862 CCCTGCCAGGAGAGGGAGGAAGG + Intronic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1042380146 8:68104172-68104194 CACCAGCAGTAGAGGTAGGGAGG - Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1045334973 8:101192855-101192877 TAATTTCAGTAGAGGGAGGAGGG + Intronic
1046391410 8:113577432-113577454 CACAGGCAGTACAGGAAGCATGG - Intergenic
1047994727 8:130323598-130323620 AACAGACAGTAGAGGGAGGTAGG - Intronic
1048223563 8:132564669-132564691 CACATGGAGTAGAGGGTGGAGGG + Intergenic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1048331048 8:133471017-133471039 CATTGGCCGTGGAAGGAGGAAGG - Intronic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1049243508 8:141550361-141550383 CACATGCAGCAGAGGGAGCAGGG + Intergenic
1049589082 8:143447623-143447645 CACAGGCCGTAGAGGAAGCATGG + Intronic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1051348584 9:16175723-16175745 CATTGGCAGAAGAGGATGGATGG + Intergenic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1056520154 9:87393718-87393740 CACTGGCATCGTAGGGAGGAGGG - Intergenic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1058504536 9:105654765-105654787 CACTGGGAGTAGATGGGGTAGGG + Intergenic
1058710906 9:107678269-107678291 CACTTGAACTTGAGGGAGGATGG + Intergenic
1058721906 9:107772183-107772205 CACAGGCAGTACAGGGGGCATGG + Intergenic
1058783949 9:108367181-108367203 CACAGGCTGTACAGGGAGCATGG - Intergenic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1059951298 9:119465501-119465523 CACAGGCAGTACAGGGAGCATGG + Intergenic
1060242402 9:121915096-121915118 CACTGGCAGTGGTGGTGGGAGGG + Intronic
1060612877 9:124984404-124984426 CACTTACAGGAGAGCGAGGAAGG + Intronic
1060995451 9:127872965-127872987 CACTGGCACTGGAGGGAGCCCGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1062343277 9:136103306-136103328 CACTGGAAGAAGGTGGAGGAGGG - Intergenic
1185754069 X:2638660-2638682 CACAGGCAGTACAGGAAGCACGG - Intergenic
1186983761 X:14987759-14987781 CACTATCAGTAGGTGGAGGATGG + Intergenic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1188147452 X:26630795-26630817 CACTGACAGTAGATGGATGGAGG - Intergenic
1188362584 X:29273822-29273844 CACTGGCAGGAGTGGGGGCATGG + Intronic
1190461911 X:50685135-50685157 CCCTGGCAGTAGCAGGACGAAGG + Intronic
1190689052 X:52898307-52898329 CACTAGCAGTGGAGAGAGAAAGG + Exonic
1190696931 X:52957485-52957507 CACTAGCAGTGGAGAGAGAAAGG - Intronic
1191225681 X:58040529-58040551 CAATGGCAGTACAGTGAGGGAGG - Intergenic
1191841950 X:65519469-65519491 CACTGGCAGTGGAGATGGGAGGG + Intronic
1191859832 X:65657094-65657116 CACTGGCAGTGGAGATGGGATGG + Intronic
1191978441 X:66899528-66899550 CACTGACAGTGGTGGGAGAAGGG + Intergenic
1192210914 X:69127171-69127193 CCCTGGCAGTGGAGAGGGGAGGG - Intergenic
1192270956 X:69578863-69578885 AATTGGCAGTGTAGGGAGGATGG - Intergenic
1192550519 X:72049661-72049683 CACTGGCAGTAAAAGGGTGATGG - Intergenic
1193093529 X:77521337-77521359 AAATGGCAGTAGGGGGTGGAGGG + Intronic
1193194965 X:78620441-78620463 CACTGGCAGGAGATGGGGAAGGG + Intergenic
1193827173 X:86240946-86240968 CACAGGCTGTAGAGGAAGCATGG - Intronic
1194220037 X:91178295-91178317 TACTGCCAGTGGATGGAGGAGGG + Intergenic
1194739360 X:97554292-97554314 CACTGAGAGGAGAGGTAGGAGGG - Intronic
1194872747 X:99153295-99153317 CACTGGCAGTGGAGGGCTGCAGG - Intergenic
1195658138 X:107352839-107352861 CACCGGCAGAAGATGGTGGATGG - Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197501397 X:127245881-127245903 CACTGGCTGTACAGTGAGCATGG - Intergenic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1199274507 X:145925758-145925780 CACTGCCAGTGGTGGGAGAAGGG - Intergenic
1200370106 X:155715928-155715950 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1200556548 Y:4642056-4642078 TACTGCCAGTGGATGGAGGAGGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic