ID: 1137722336

View in Genome Browser
Species Human (GRCh38)
Location 16:50634761-50634783
Sequence TCTGGGTTCCAGAAGCATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137722336_1137722344 8 Left 1137722336 16:50634761-50634783 CCTGGATGCTTCTGGAACCCAGA 0: 1
1: 0
2: 2
3: 28
4: 223
Right 1137722344 16:50634792-50634814 TGCTTGTCTCCTTTTGGGGCTGG 0: 1
1: 0
2: 0
3: 27
4: 285
1137722336_1137722345 12 Left 1137722336 16:50634761-50634783 CCTGGATGCTTCTGGAACCCAGA 0: 1
1: 0
2: 2
3: 28
4: 223
Right 1137722345 16:50634796-50634818 TGTCTCCTTTTGGGGCTGGACGG 0: 1
1: 0
2: 5
3: 25
4: 261
1137722336_1137722339 2 Left 1137722336 16:50634761-50634783 CCTGGATGCTTCTGGAACCCAGA 0: 1
1: 0
2: 2
3: 28
4: 223
Right 1137722339 16:50634786-50634808 TGACCCTGCTTGTCTCCTTTTGG 0: 1
1: 0
2: 1
3: 13
4: 195
1137722336_1137722340 3 Left 1137722336 16:50634761-50634783 CCTGGATGCTTCTGGAACCCAGA 0: 1
1: 0
2: 2
3: 28
4: 223
Right 1137722340 16:50634787-50634809 GACCCTGCTTGTCTCCTTTTGGG 0: 1
1: 0
2: 2
3: 15
4: 181
1137722336_1137722341 4 Left 1137722336 16:50634761-50634783 CCTGGATGCTTCTGGAACCCAGA 0: 1
1: 0
2: 2
3: 28
4: 223
Right 1137722341 16:50634788-50634810 ACCCTGCTTGTCTCCTTTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137722336 Original CRISPR TCTGGGTTCCAGAAGCATCC AGG (reversed) Exonic
900477249 1:2881780-2881802 TCTGGGGTACAGAGGCCTCCTGG - Intergenic
902341231 1:15784849-15784871 TCTGGGCACCAGAAGGCTCCTGG + Intronic
902366007 1:15975010-15975032 TCTGGGGGACAGAAGCCTCCCGG + Intronic
903102884 1:21048476-21048498 TCTGGGCTGCAGGAGCAACCAGG - Intronic
903144840 1:21364686-21364708 CCTGTGTTCCAGGAACATCCAGG - Intergenic
904779075 1:32931311-32931333 TTTGCCTTCCAGAAGCATACTGG + Intergenic
905629495 1:39510860-39510882 TCTGGGTCCCAGGACCAGCCGGG + Intronic
909992442 1:82239838-82239860 TCTTGCTTAAAGAAGCATCCTGG + Intergenic
913075741 1:115338903-115338925 CCTGGGTTCCAGGAACTTCCCGG + Intergenic
913396935 1:118381766-118381788 TCTGGCTTCCAGATGGATCTGGG - Intergenic
915428369 1:155845980-155846002 TCTGGGTACCAGAAGCTACCTGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916332035 1:163628147-163628169 TCTGGCTTCCAGTTGCATTCTGG - Intergenic
916659506 1:166908665-166908687 TGAGGGTACCAGAAGAATCCAGG + Exonic
916737401 1:167620045-167620067 ACTGGCTCCCAGAAGCATTCAGG - Intergenic
919803454 1:201367006-201367028 CCCTGATTCCAGAAGCATCCAGG + Intronic
920034583 1:203057747-203057769 TCTGAGTCCCACAAGCACCCTGG - Intronic
920122978 1:203672652-203672674 CCTGGGTTCCAGAGGCAACCAGG + Intronic
924036093 1:239939733-239939755 TCTGGCTTTTGGAAGCATCCAGG - Intergenic
924042337 1:239996554-239996576 TCTGGCTTTTGGAAGCATCCAGG + Intergenic
1062848380 10:725373-725395 TCTGGGTTTCAGAAGCTTAAAGG + Intergenic
1063173447 10:3530360-3530382 CCTGGGGTACAGCAGCATCCCGG - Intergenic
1065605816 10:27416401-27416423 CCTGGGTTCCTGAAGCATCATGG + Intergenic
1066569945 10:36760494-36760516 TCTGCATTCCAGTAGCTTCCAGG + Intergenic
1066670074 10:37827741-37827763 TCTGGTTGCCAGAAGCAAACAGG + Intronic
1067289353 10:44929983-44930005 CCTGGGATCCAGAAGCAGGCGGG + Intronic
1067582785 10:47456097-47456119 TCTGGGCTCCAGGGACATCCAGG - Intergenic
1067837741 10:49652066-49652088 TCTAGGGTCTAGAAGCATCCTGG + Intronic
1068600624 10:58952770-58952792 TCTGGGTTCCAGAAGCTAGGAGG - Intergenic
1069250211 10:66257663-66257685 TCTGGTTTCAAGAGGCATCAGGG - Intronic
1069544225 10:69317846-69317868 TCTGTGTTCCGGAAGCCTCCAGG - Intronic
1069958113 10:72063906-72063928 TTTGGGATACAGAAGGATCCTGG - Intronic
1070173518 10:73950943-73950965 TCTGGGCTCCCATAGCATCCTGG + Intergenic
1070707545 10:78651642-78651664 TCTGGGTGCCAGAAACTTCATGG - Intergenic
1071665956 10:87558731-87558753 TATAGGTTCCAGAAGCAGCTAGG + Intergenic
1071813525 10:89208285-89208307 TGTGAGTTCCTGAAGCCTCCCGG + Intergenic
1072690709 10:97570804-97570826 TCTGGGCTCCAGGGGCCTCCTGG - Exonic
1073111501 10:101065657-101065679 TCTGGCTTCCAGAAGCTGCAGGG + Intronic
1074707601 10:116149117-116149139 CCTGTTTTCCAGGAGCATCCTGG - Intronic
1074882295 10:117668428-117668450 CCGGGGTTCCAGATGCATCTGGG + Intergenic
1075203031 10:120422238-120422260 CCTGGGGTCCTGAAGCCTCCTGG - Intergenic
1075935734 10:126339676-126339698 TGTGGGTTCCAGGAACAGCCAGG + Intronic
1076424240 10:130356159-130356181 TCTGGGTTACAAAAGCAGGCTGG - Intergenic
1076803339 10:132843248-132843270 ACTGCCTTCCAGAAGCTTCCAGG + Intronic
1076849352 10:133085599-133085621 TGTGTGTTCCAGAAGTCTCCGGG - Intronic
1076988715 11:257844-257866 TCAGGGTTCCAGACTCATCCTGG + Intergenic
1077303394 11:1857203-1857225 TCTGGCTTCCAGAATCAGCGGGG - Intronic
1079358831 11:19753535-19753557 TCTGGGTTGCAGTAACCTCCAGG + Intronic
1081834664 11:46143792-46143814 TCTGGGCACCAGAAGGTTCCTGG + Intergenic
1081865349 11:46356651-46356673 TTTGTTTGCCAGAAGCATCCAGG + Intronic
1081940346 11:46936303-46936325 TCTGACCTCTAGAAGCATCCAGG + Intergenic
1082014966 11:47478461-47478483 CCTGGGTTCTAGAAGCTTCAAGG + Intronic
1084091524 11:66882167-66882189 TCTGGTTGCAAGAGGCATCCTGG - Intronic
1084795405 11:71501767-71501789 CCTGGGTTCCAGAAGGTTCTGGG + Exonic
1084796234 11:71506302-71506324 GCTGTTTTCCAGAAGGATCCTGG - Intronic
1085509471 11:77080909-77080931 ACTGGGTTCCTGAAGCTCCCTGG + Intronic
1088712672 11:112522818-112522840 TCTGAGTTCCAGAAGCAGAATGG + Intergenic
1088962643 11:114684879-114684901 TCTGTGTTCCTGAAGCTTCTTGG - Intronic
1089379577 11:118018127-118018149 AGCAGGTTCCAGAAGCATCCAGG + Intergenic
1090423076 11:126589018-126589040 CCTGGGTTCCAGGAAAATCCTGG - Intronic
1090949836 11:131463886-131463908 TCTGGGAGCCAGAAGCTGCCAGG - Intronic
1091179361 11:133589478-133589500 TCTGGTGTCCAGCATCATCCAGG + Intergenic
1092140393 12:6179604-6179626 TCTGGAAGCCAGAAGCCTCCAGG + Intergenic
1094035755 12:26068711-26068733 TCTGGGTCCCTGAAGCGACCTGG + Exonic
1094218265 12:27969042-27969064 TCCGAGTTTCAGAAGCTTCCCGG + Intronic
1096334817 12:50746033-50746055 TCTGGGTTGCCAAAGCAGCCAGG + Exonic
1097069863 12:56346945-56346967 TCTGTGCTCCAGACGCATCATGG - Exonic
1098265800 12:68718040-68718062 TCTGGCTTTCAGCAGGATCCAGG + Intronic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099010131 12:77281796-77281818 TCTGGATTACAGAAGTATCCAGG - Intergenic
1103913692 12:124365229-124365251 TCTGGGTGCCAGAAGCTGGCAGG + Intronic
1105546503 13:21354688-21354710 TTGGGGTTCCAGCAGCATCCTGG + Intergenic
1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG + Intergenic
1106578754 13:30999883-30999905 TCTGGGATCTAGAAGGATCACGG + Intergenic
1106640118 13:31575035-31575057 TCTGCATTCCAGAAACATACTGG - Intergenic
1107046794 13:36001393-36001415 TATGGGTTCCAGAAGTCTCCTGG + Intronic
1107719603 13:43234071-43234093 TCTAGATTCCAGAAGCTTCAGGG + Intronic
1108000586 13:45902318-45902340 TTTGGGATCCGGAAGCAGCCAGG + Intergenic
1108456589 13:50621214-50621236 TCTTTGCTACAGAAGCATCCTGG + Intronic
1110730863 13:78877188-78877210 GCTGGGTTGCAACAGCATCCAGG + Intergenic
1114893301 14:26952912-26952934 TCTGGGTTCTAAATCCATCCTGG + Intergenic
1115783022 14:36791883-36791905 TTTGGCTCCCAGAAGCCTCCCGG - Intronic
1116186684 14:41607432-41607454 TCTGTGTTCCGGAAAGATCCTGG + Intergenic
1116584625 14:46687068-46687090 GCTGGATTCTAGAAGCATCCAGG + Intergenic
1121259240 14:92553997-92554019 CATTGGTTCCAGAAGCATCCAGG - Intronic
1121774368 14:96580859-96580881 GCTGGGTTCCAGAGGGATGCAGG - Intergenic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1126110888 15:45174085-45174107 TCTGGGTTCCCATAGCCTCCTGG + Intronic
1127712466 15:61613434-61613456 TCTGGGAGCCAGAAAAATCCAGG - Intergenic
1128163346 15:65439363-65439385 TGTGGTTTCCAGAACCATCCTGG + Intergenic
1128461344 15:67870094-67870116 TCTGGGTTGCAGTTTCATCCAGG + Intergenic
1129703203 15:77779906-77779928 ACTGGGTTCCAGTATCCTCCTGG - Intronic
1130209933 15:81913784-81913806 TCTGGGTTTCAGACACATTCTGG - Intergenic
1130883402 15:88073933-88073955 TATGTATTCCAGAAGCAACCAGG + Intronic
1132366161 15:101258589-101258611 TCTGGGTATCAGAATCATCTTGG - Intergenic
1132392708 15:101450559-101450581 TCTGTGTTCCAGACACAGCCAGG - Intronic
1132575115 16:660574-660596 GCTGGGCCCCAGCAGCATCCGGG + Intronic
1132715493 16:1288165-1288187 CCTGGGCTCCAGACGCGTCCTGG - Intergenic
1133176811 16:4021601-4021623 TCTGGGCTCCACCAGCAGCCTGG + Intronic
1133350573 16:5098045-5098067 GCTGGGCTTCAGAAGCGTCCAGG + Intergenic
1134043514 16:11085196-11085218 CCTGGGTTCCAGGAGGATCACGG + Intronic
1134236688 16:12471819-12471841 TCTGGGTGCTGGAAACATCCAGG - Intronic
1136768331 16:32810983-32811005 GCTGGGCTCCAGGAGCAGCCCGG - Intergenic
1137009587 16:35309552-35309574 TATGGGGTCCTGCAGCATCCAGG + Intergenic
1137023491 16:35452406-35452428 TCTGGGGTCCTGCAGCGTCCAGG + Intergenic
1137028264 16:35499501-35499523 TCTGGGGTCCTGAAGCGTCCAGG + Intergenic
1137247958 16:46720791-46720813 TATGGGTTCCCCAGGCATCCTGG - Intronic
1137722336 16:50634761-50634783 TCTGGGTTCCAGAAGCATCCAGG - Exonic
1139122704 16:64040428-64040450 ACTGGGTTATAGAAGCCTCCAGG + Intergenic
1139612872 16:68071372-68071394 TCGGGGTTCCAACAGCATCCTGG - Intronic
1141294243 16:82751952-82751974 TCTGTCTTCCAGAAACATACAGG + Intronic
1141647427 16:85375229-85375251 ACTGGGATCCAGAAGCTCCCAGG - Intergenic
1142270651 16:89087734-89087756 TGTGGAATCCAGAAGCAGCCTGG + Intergenic
1142314678 16:89336165-89336187 TCTGAGCTCCAGAGGTATCCTGG - Intronic
1203070723 16_KI270728v1_random:1072999-1073021 GCTGGGCTCCAGGAGCAGCCCGG - Intergenic
1143339911 17:6202780-6202802 TCTGGGTTCCAGCAGCAAATTGG + Intergenic
1143724046 17:8833181-8833203 TGTGGGATCCAGAAGCCTTCGGG - Intronic
1146637782 17:34518921-34518943 TCTGGATCCCAGATGGATCCTGG + Intergenic
1150271472 17:63868521-63868543 TCTGAATTAAAGAAGCATCCAGG + Intergenic
1150277144 17:63906159-63906181 TCTGAATTAAAGAAGCATCCAGG + Intergenic
1150552279 17:66221734-66221756 TCTGGGTTCCTGAAGCTACTTGG - Intronic
1150576778 17:66437680-66437702 TGTGGGTCCCAGAAGCAACTGGG + Intronic
1152320861 17:79608355-79608377 TCTGGGTGCCAGGAGGAGCCAGG - Intergenic
1152561519 17:81081195-81081217 TCTGGGCTCAGGAAGCCTCCAGG - Intronic
1152677810 17:81650738-81650760 TCTGGGGTCCAGCAGGCTCCCGG + Exonic
1155142793 18:23058184-23058206 TCTGTGTTCATGCAGCATCCTGG - Intergenic
1157557347 18:48621563-48621585 CCTGGGCTCCAGGAGCAGCCTGG - Intronic
1158480745 18:57819624-57819646 TCTGTATTCCAGAAACAGCCTGG - Intergenic
1159247519 18:65828839-65828861 ACTTGGTTCCAGAATAATCCAGG + Intronic
1160059199 18:75514317-75514339 TCTGTGTCCCAGGAACATCCCGG - Intergenic
1160143349 18:76345973-76345995 TCTAGCTTCCACAAGCAGCCAGG + Intergenic
1160319952 18:77881009-77881031 TCTCATTCCCAGAAGCATCCTGG + Intergenic
1160608312 18:80068653-80068675 TCTGTGATCGAGAAGCATCAGGG - Intronic
1160876292 19:1297704-1297726 TCGGGCCCCCAGAAGCATCCTGG - Intronic
1160989417 19:1854410-1854432 CCTGGATGGCAGAAGCATCCTGG + Exonic
1162498633 19:11038206-11038228 TGATGGTTCCAGAAGCCTCCTGG + Intronic
1165136947 19:33675495-33675517 TCTCGCTTCCAAAAACATCCTGG + Intronic
1166687267 19:44802822-44802844 TCTGGGTTCCTGTAGCCCCCTGG - Intergenic
1167104123 19:47420363-47420385 TCTAGGTTTCAGAATCAGCCTGG - Intergenic
1167263312 19:48470732-48470754 TCCGGGTTCCAGAAGCGTGATGG + Intronic
1167294992 19:48644737-48644759 TCTGGGTCCTAGAAGAATCTTGG + Intronic
1168419497 19:56191914-56191936 TCTGTGAACCAGATGCATCCGGG - Exonic
925985041 2:9207818-9207840 TCTGGGTCCAAGAAGCCTCCAGG + Intronic
926157455 2:10464877-10464899 CCTGGGTCCCAGCGGCATCCTGG + Intergenic
926357172 2:12051723-12051745 TCTGGATTACAAAAGCTTCCAGG - Intergenic
927420220 2:22923206-22923228 TCTGGGCTCCTGGAGCAACCTGG - Intergenic
929589710 2:43136927-43136949 TCTGGGCACCAGAAACATACAGG + Intergenic
932413875 2:71562374-71562396 CCTGGGGTTCAGAGGCATCCAGG - Intronic
933273267 2:80256461-80256483 TCTCTTTTCCAGAAACATCCAGG + Intronic
935433351 2:103002106-103002128 CCTGGGTGCCAGTAGTATCCTGG - Intergenic
936050920 2:109223078-109223100 TCTGGGATGGAGAAGCATCAGGG - Intronic
937084346 2:119160676-119160698 TCTGGGTGCCGGGAGGATCCTGG - Intergenic
939657513 2:144846638-144846660 TCAAGGTTCCACAAGCATCCAGG + Intergenic
940250685 2:151672617-151672639 TGTGGGTTTCAGAAGCCTCCAGG - Exonic
945311687 2:208321260-208321282 GCTGGGTTCCAGAAACATTTAGG + Intronic
948263733 2:236622752-236622774 TTTGGGGCCCAGAAGCCTCCTGG + Intergenic
1170215377 20:13885613-13885635 TCTGGGGTACAGAAACACCCAGG + Intronic
1171052596 20:21873917-21873939 TCTGATTCCCAGAAGAATCCTGG - Intergenic
1171195937 20:23199421-23199443 TCTGGGTCACAGAAGGATGCTGG + Intergenic
1171519812 20:25766964-25766986 TCTGGGTTTCAGCAGCCTCAGGG + Intronic
1171557107 20:26089529-26089551 TCTGGGTTTCAGCAGCCTCAGGG - Intergenic
1173152277 20:40577708-40577730 TGTAGGTACCAGAAGCTTCCTGG + Intergenic
1175165229 20:57038862-57038884 GGTGGGTTCCAGAAGAAGCCGGG - Intergenic
1178589625 21:33898450-33898472 TCTGTGCCCCAGAAGCAGCCTGG - Exonic
1179145810 21:38766424-38766446 TCTGGCTTCCAGAACCATAAGGG + Intergenic
1179247890 21:39649350-39649372 TGTGGGTTCCAGAAACAGCACGG - Intronic
1181930242 22:26395012-26395034 TCTGGGTTTCTGAGGCATCTGGG - Intergenic
1182437327 22:30339053-30339075 TCTTAGTTCCAGAAGCATTGTGG - Intronic
1182807686 22:33089057-33089079 TCTGGGTTCCAACAGTATCCTGG + Intergenic
1184244978 22:43231270-43231292 TCTGGGCTCCTGCTGCATCCTGG + Intronic
1184991781 22:48175198-48175220 ACTGAGTCCCAGAGGCATCCTGG + Intergenic
1185019630 22:48366671-48366693 TCTGGGCTCCAGGAGCTCCCTGG + Intergenic
949756607 3:7418622-7418644 TCTTTGTGCCAGCAGCATCCTGG - Intronic
950790680 3:15469313-15469335 TTGGGGTTCCAGAAGCTTCCTGG - Intronic
951256888 3:20460250-20460272 TTTGGTTTCCAGAGGCATCTGGG + Intergenic
951607584 3:24452943-24452965 TCGGGCTTCAAGTAGCATCCTGG - Intronic
952787140 3:37166664-37166686 TCTGGGTTCAAGCAACGTCCAGG - Intronic
954760954 3:52873500-52873522 TCTCGGCTCCAGAACCACCCAGG + Intronic
957054842 3:75435392-75435414 GCTGGGCTTCAGAAGCGTCCAGG + Intergenic
957459450 3:80497702-80497724 GCTGGGTTCCAGCAGCATCCAGG + Intergenic
962388116 3:134949276-134949298 TCTGGGGTCCAGGAGGACCCTGG + Intronic
963173693 3:142277176-142277198 GCTGTGTTCCAGAAGCTGCCAGG - Intergenic
963312477 3:143723787-143723809 TCTGTGGTCCAGCAGCATCCTGG + Intronic
964954253 3:162333220-162333242 TCTGGCATCCAGTACCATCCAGG + Intergenic
966461909 3:180185949-180185971 TCTGGGCTGTAGAAGAATCCAGG - Intergenic
966826009 3:183965604-183965626 TTTGGGTCCAAAAAGCATCCCGG - Intronic
966919011 3:184600462-184600484 TCTGGGTTGCAAAAGTCTCCTGG - Intronic
967929011 3:194677008-194677030 TGTGCGTTCCAGCACCATCCAGG - Intergenic
969304912 4:6320028-6320050 TCTGGCTTCCTGAAGAATCCAGG + Intergenic
969623489 4:8290683-8290705 TCTGTGTTCCAGAAGCTGCGTGG - Intronic
971147732 4:23997035-23997057 TCTGGGTGTCAGAAGAATCATGG + Intergenic
973834264 4:54793348-54793370 TCAAGGTCCCAGAAGCATGCCGG + Intergenic
978650504 4:110998310-110998332 TCTTGGGTCCAGAAGCATCCCGG + Intergenic
985119664 4:186627486-186627508 TCTGGGTCCCGGAACCGTCCAGG + Intronic
985619352 5:945831-945853 TCTGGGTTGGAGAGGCAGCCCGG + Intergenic
988634771 5:32970759-32970781 TCTGGCTTCCAGAACCATTAGGG - Intergenic
990370126 5:55109306-55109328 TGTGGGTTCCAAAAGCATGAAGG - Intronic
996337756 5:122403364-122403386 CCTGGCTTCCTGCAGCATCCGGG - Intronic
997024686 5:130044836-130044858 TCTGTGTTACATCAGCATCCGGG - Intronic
998489761 5:142536410-142536432 ACTGGGTTCCTGCAGCTTCCAGG + Intergenic
998631080 5:143899319-143899341 GCTGGGTTCCAGCAGAATGCAGG + Intergenic
1001046068 5:168372737-168372759 TCTGGGTTTCAGTAGCACCCTGG + Intronic
1001090889 5:168740083-168740105 TATGCTTTTCAGAAGCATCCAGG - Intronic
1003405188 6:5822076-5822098 CTGGGGTTCCAGCAGCATCCTGG - Intergenic
1004484247 6:16050872-16050894 CCTTAGTTCCAGAACCATCCAGG + Intergenic
1005167610 6:22942581-22942603 ACTGGCTTCCAGAAGCAATCAGG - Intergenic
1006105824 6:31715688-31715710 TCTGGCTTCCAGAACCCTCCAGG + Intronic
1006919580 6:37618647-37618669 CCTGGGTTCCAGATGTCTCCAGG + Intergenic
1007514514 6:42400625-42400647 TGTGGGTTCCAGAAGCAAGGGGG + Intronic
1016045069 6:139472660-139472682 TGTGGGTTCCATAAGCAGCAAGG - Intergenic
1017155379 6:151318190-151318212 TCTGCAGTCCAGAAGAATCCAGG + Intronic
1017455694 6:154599240-154599262 TCTGTGGTCCAGAAGAAACCAGG + Intergenic
1017539470 6:155385451-155385473 TCTGGGGTGCAAAAGCAGCCGGG - Intergenic
1019056789 6:169229521-169229543 CCTGGGTTCCAGGAGCAGCGAGG - Intronic
1019333553 7:471967-471989 GCTGCGTTCCGGAAGCTTCCTGG - Intergenic
1019356415 7:582285-582307 GCGGGGTCCCAGGAGCATCCAGG + Intronic
1020096095 7:5370495-5370517 CCTGGGCTCCAGCAGCACCCGGG + Exonic
1023165496 7:37339300-37339322 ACTGTGTACAAGAAGCATCCAGG - Intronic
1024679373 7:51668623-51668645 TCTTGGTTCCAGTAGCCTACTGG + Intergenic
1029904504 7:104077458-104077480 TCTGGATGCCAGATGCATCTGGG + Intergenic
1031988234 7:128177810-128177832 TCAGGGTGTCAGCAGCATCCAGG + Intergenic
1032183574 7:129703396-129703418 TCTGGTTTCCAGAACTCTCCAGG + Intronic
1032202189 7:129829888-129829910 TCTGGGCTCTGGAGGCATCCAGG + Intergenic
1033145913 7:138869802-138869824 TGTGTGTCCCAGAAGCTTCCCGG - Intronic
1033722590 7:144077640-144077662 TCTGGGCTACAATAGCATCCTGG - Intergenic
1034464133 7:151215828-151215850 TCTGGGTTCAAGAAGCAGGTAGG + Intronic
1034887554 7:154809567-154809589 TGTGTGCTCCACAAGCATCCGGG + Intronic
1035320731 7:158027644-158027666 TGTGGGTTCCAGAAGCATTGAGG - Intronic
1037599541 8:20382305-20382327 ACTGGGTTACAGAAGCAGACAGG - Intergenic
1037888745 8:22610074-22610096 GCTTGGGACCAGAAGCATCCTGG - Intronic
1039650545 8:39336476-39336498 CCAGGGTTCCAGATGCATCAGGG - Intergenic
1041086005 8:54257029-54257051 TCTTGGTTCCAGGATCATGCAGG + Intergenic
1042080422 8:65045677-65045699 TCTATGTACCAGAAGCATGCTGG - Intergenic
1042351125 8:67778814-67778836 GCTGGGTGGCAGAAGCACCCAGG - Intergenic
1042662838 8:71174583-71174605 TCTGGTTTCCAAAACCATTCTGG + Intergenic
1044901539 8:96950925-96950947 TCTGGGTTTCAGAGGCAAGCAGG - Intronic
1048351771 8:133622403-133622425 TCTGGTTTCCAGGACCATCCTGG + Intergenic
1048745518 8:137610598-137610620 TCTAGCTTCCAGAGGCAGCCTGG + Intergenic
1050282549 9:4066295-4066317 TAGGGTTTCCAGAAGCATCCAGG + Intronic
1053308137 9:36998092-36998114 TATGGCTTTCAGAAGCAGCCAGG - Intronic
1054740088 9:68797242-68797264 TCTGGGTTCCTGTAGCATCTTGG - Intronic
1056926954 9:90843487-90843509 TCAGGGTCCCAGCAGCATACAGG - Intronic
1058814495 9:108670838-108670860 TCTGGCCTCCAGAAACACCCAGG + Intergenic
1060971142 9:127738829-127738851 TCAGGGTGCCAGCAGCAGCCAGG - Exonic
1061160886 9:128893069-128893091 CCTGTCTTCGAGAAGCATCCAGG + Intronic
1062169334 9:135126226-135126248 TCAGGTTTCCAGATGCTTCCTGG - Intergenic
1062210273 9:135359853-135359875 TCTGGGGCCCAGTAGAATCCAGG - Intergenic
1185614317 X:1411500-1411522 ACTGGGCTCCAGGAGCAGCCTGG + Intronic
1190953846 X:55172069-55172091 TGGGGGTTCCAGATGCTTCCAGG - Intronic
1195372587 X:104193365-104193387 TCTGGTTTGAAGAAGTATCCTGG - Exonic
1196652164 X:118178914-118178936 TCAGGGTTCCAGAAGATTCCTGG - Intergenic
1197346060 X:125326730-125326752 TCTGGGCACCAGAAGGCTCCTGG - Intergenic
1199767236 X:150950111-150950133 TCAAGGTCCCAGAAGCAGCCAGG + Intergenic
1200080117 X:153572110-153572132 ACTGGGTCCCATAAGCAGCCAGG + Intronic