ID: 1137726282

View in Genome Browser
Species Human (GRCh38)
Location 16:50658892-50658914
Sequence GCTCCTGTTGCTCCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137726282_1137726283 -3 Left 1137726282 16:50658892-50658914 CCAGCATGTGGAGCAACAGGAGC No data
Right 1137726283 16:50658912-50658934 AGCAAAACACCCCACAGAAGTGG No data
1137726282_1137726289 22 Left 1137726282 16:50658892-50658914 CCAGCATGTGGAGCAACAGGAGC No data
Right 1137726289 16:50658937-50658959 AGTGTTTCTGAGGATCAAGAGGG No data
1137726282_1137726287 12 Left 1137726282 16:50658892-50658914 CCAGCATGTGGAGCAACAGGAGC No data
Right 1137726287 16:50658927-50658949 AGAAGTGGTCAGTGTTTCTGAGG No data
1137726282_1137726288 21 Left 1137726282 16:50658892-50658914 CCAGCATGTGGAGCAACAGGAGC No data
Right 1137726288 16:50658936-50658958 CAGTGTTTCTGAGGATCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137726282 Original CRISPR GCTCCTGTTGCTCCACATGC TGG (reversed) Intergenic
No off target data available for this crispr