ID: 1137726718

View in Genome Browser
Species Human (GRCh38)
Location 16:50661617-50661639
Sequence CAGCTAGAAAAACTTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137726710_1137726718 13 Left 1137726710 16:50661581-50661603 CCCTCGATAGGCCTAAGGCAGAG No data
Right 1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG No data
1137726711_1137726718 12 Left 1137726711 16:50661582-50661604 CCTCGATAGGCCTAAGGCAGAGC No data
Right 1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG No data
1137726712_1137726718 2 Left 1137726712 16:50661592-50661614 CCTAAGGCAGAGCTCCCTTGCTT No data
Right 1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG No data
1137726708_1137726718 23 Left 1137726708 16:50661571-50661593 CCTAGGGGTGCCCTCGATAGGCC No data
Right 1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137726718 Original CRISPR CAGCTAGAAAAACTTGGCTT TGG Intergenic
No off target data available for this crispr