ID: 1137727257

View in Genome Browser
Species Human (GRCh38)
Location 16:50665285-50665307
Sequence AGCCCAGAAGCCCCAAAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137727257_1137727265 -3 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727265 16:50665305-50665327 GCTGAGGGAAGAGGATGGAGGGG No data
1137727257_1137727266 5 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727266 16:50665313-50665335 AAGAGGATGGAGGGGCAGAAAGG No data
1137727257_1137727269 30 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727269 16:50665338-50665360 GTGAGGTCCCAAACCCCAAGTGG No data
1137727257_1137727267 6 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727267 16:50665314-50665336 AGAGGATGGAGGGGCAGAAAGGG No data
1137727257_1137727263 -5 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727263 16:50665303-50665325 GGGCTGAGGGAAGAGGATGGAGG No data
1137727257_1137727262 -8 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727262 16:50665300-50665322 TCTGGGCTGAGGGAAGAGGATGG No data
1137727257_1137727264 -4 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727264 16:50665304-50665326 GGCTGAGGGAAGAGGATGGAGGG No data
1137727257_1137727268 13 Left 1137727257 16:50665285-50665307 CCGCCTTTTGGGGCTTCTGGGCT No data
Right 1137727268 16:50665321-50665343 GGAGGGGCAGAAAGGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137727257 Original CRISPR AGCCCAGAAGCCCCAAAAGG CGG (reversed) Intergenic
No off target data available for this crispr