ID: 1137728825

View in Genome Browser
Species Human (GRCh38)
Location 16:50675028-50675050
Sequence CATTTAATCCTCACTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137728825_1137728828 1 Left 1137728825 16:50675028-50675050 CCTCACCCAGTGAGGATTAAATG 0: 1
1: 0
2: 3
3: 25
4: 212
Right 1137728828 16:50675052-50675074 GTTAATGCACTGAAACCACATGG 0: 1
1: 0
2: 0
3: 12
4: 137
1137728825_1137728831 24 Left 1137728825 16:50675028-50675050 CCTCACCCAGTGAGGATTAAATG 0: 1
1: 0
2: 3
3: 25
4: 212
Right 1137728831 16:50675075-50675097 AGCTGTGCCCGGCATGCCATTGG 0: 1
1: 0
2: 0
3: 12
4: 126
1137728825_1137728829 13 Left 1137728825 16:50675028-50675050 CCTCACCCAGTGAGGATTAAATG 0: 1
1: 0
2: 3
3: 25
4: 212
Right 1137728829 16:50675064-50675086 AAACCACATGGAGCTGTGCCCGG 0: 1
1: 0
2: 1
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137728825 Original CRISPR CATTTAATCCTCACTGGGTG AGG (reversed) Intronic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
901912109 1:12467458-12467480 TATCTGATCCTGACTGGGTGTGG - Intronic
903027204 1:20437912-20437934 CATTTAATCCTCCCTCTGTGAGG - Intergenic
903781491 1:25822961-25822983 CATTAAATCCCCACTGTGGGGGG + Intronic
905071561 1:35230329-35230351 CATTTTATCCTGACTTGGTGAGG + Intergenic
907592467 1:55688444-55688466 TGTTTAATCCTCTCTGGGAGAGG + Intergenic
909310524 1:74140979-74141001 CAATTAATTCTGATTGGGTGAGG - Intronic
909912835 1:81281366-81281388 CATTAACTACTCACTGGATGAGG + Intergenic
911889289 1:103346448-103346470 CATTTTATCCTCCCTGGGGCAGG + Intergenic
912777136 1:112512943-112512965 TATTACATCCTCACTGAGTGTGG - Intronic
913496124 1:119429864-119429886 CAGGGAATCCTCAGTGGGTGGGG + Intergenic
915061342 1:153188397-153188419 AAATTCCTCCTCACTGGGTGGGG - Intergenic
916270514 1:162936447-162936469 AATGTAATTCTCACTGTGTGTGG - Intergenic
916655510 1:166872173-166872195 CATTTAATCCTCAATGGTGGAGG + Intronic
917433644 1:174997708-174997730 CATTTTAGGCTCACTGGCTGGGG + Intergenic
917690071 1:177459747-177459769 CATTTTATCCTTACTAGGTGTGG + Intergenic
918349463 1:183638987-183639009 CATTGAATCCTGGCTGGGCGTGG + Intronic
918934916 1:190910069-190910091 AATTTAATCCTAACTGGGTTTGG + Intergenic
919031800 1:192251876-192251898 CCATTATTCCTCACTGGGTGGGG - Intergenic
920305886 1:205017838-205017860 CATTGAGTCCTCCCTAGGTGGGG - Exonic
921096650 1:211892418-211892440 CATTTAAGAATCACTGGTTGGGG - Intergenic
924458725 1:244239317-244239339 AATCTAATCCTCACTGCCTGAGG + Intergenic
924952550 1:248898002-248898024 CCATTCCTCCTCACTGGGTGGGG + Intergenic
1063139528 10:3244074-3244096 CATTTAATCCACACAAGGTGGGG - Intergenic
1063826117 10:9899557-9899579 CATTTAATCATGAATGAGTGTGG + Intergenic
1064994644 10:21285897-21285919 CACTTAACTCTCACAGGGTGTGG - Intergenic
1066051686 10:31642518-31642540 CATTTAGTCCTCACTAGGCAAGG + Intergenic
1068059255 10:52046384-52046406 CAGTGATTCCTCACTGGATGGGG - Intronic
1070099576 10:73372573-73372595 CGTTTAATCCTGGCTGGGCGTGG - Intergenic
1070168856 10:73917372-73917394 CATCCAATCCTCACTGGGTGGGG + Exonic
1071275251 10:84048375-84048397 CAGTTAATCCTACCTGGGAGGGG - Intergenic
1072740973 10:97909205-97909227 CATTTGAAACCCACTGGGTGGGG - Intronic
1073783555 10:106864899-106864921 CTGTTCCTCCTCACTGGGTGGGG + Intronic
1074102668 10:110365762-110365784 CATTTAATCCTCATAGCATGAGG - Intergenic
1074233889 10:111565516-111565538 CCTTTAATCCTTACTGTCTGAGG + Intergenic
1077684434 11:4277732-4277754 AAATCAATCCTGACTGGGTGGGG + Intergenic
1077685606 11:4289036-4289058 AAATCAATCCTGACTGGGTGGGG - Intergenic
1078225326 11:9386245-9386267 CATGTAATCATCACTTTGTGTGG - Intronic
1078595655 11:12684270-12684292 CATTTAATTCATACTGGGTAAGG - Intronic
1078823908 11:14907888-14907910 CACTTCCTCCTCACTGAGTGTGG - Intronic
1078868511 11:15322008-15322030 CATTGAATCCTGAATTGGTGGGG - Intergenic
1080214712 11:29827492-29827514 CCATTCCTCCTCACTGGGTGGGG + Intergenic
1080844145 11:36011801-36011823 CATTTAATCCACACTGCATCGGG - Intronic
1081937375 11:46914555-46914577 CACTGAATCCTCACAGGCTGAGG + Intronic
1082757487 11:57092295-57092317 CCATTCCTCCTCACTGGGTGGGG - Intergenic
1085166824 11:74409135-74409157 CACTTAATCCAGACTGGGAGGGG + Intergenic
1085332594 11:75666653-75666675 CATTTAATCCTCACAATGTCCGG + Intronic
1087583588 11:100090599-100090621 AATTTAATTCTCACTGTCTGGGG + Intronic
1087757736 11:102073174-102073196 CATTTAATGCACACTGCCTGAGG - Intronic
1087850913 11:103028297-103028319 CATTTAATCCTCACAGTCTCTGG - Intergenic
1090837597 11:130464623-130464645 CATGTTTTTCTCACTGGGTGAGG - Intronic
1094546611 12:31410349-31410371 CATTTAATTCTCACTCTATGAGG + Intronic
1099174279 12:79402692-79402714 CATTAAATCCTCAGTGTGTGAGG + Intronic
1099922670 12:88978573-88978595 ACTTTAATTGTCACTGGGTGAGG + Intergenic
1100284010 12:93147076-93147098 TATTTAATCCTCACTGTTTTAGG - Intergenic
1101176139 12:102153596-102153618 CCTGTAATCCTCACTTTGTGTGG - Intronic
1101997951 12:109538508-109538530 CATTTAATCCTCACGTGCTCTGG - Intergenic
1102282157 12:111626906-111626928 CATTTAATCCTGTCTAGGCGGGG + Intergenic
1102690017 12:114753215-114753237 CTTTGAATCCTCCCTGGATGGGG + Intergenic
1102897571 12:116610808-116610830 CATTTAATCCTCACTGCCCCAGG - Intergenic
1103226969 12:119296108-119296130 CATTTAACCCTCACTCTATGAGG + Intergenic
1103432660 12:120902514-120902536 CACTTAATCCTTACAGGCTGTGG + Intronic
1103557701 12:121776048-121776070 CATTTGAACCCCTCTGGGTGGGG + Exonic
1103650865 12:122431326-122431348 AATTTAATAGGCACTGGGTGTGG - Intergenic
1104325372 12:127790950-127790972 CATTTAAAGCTCACTGTATGTGG - Intergenic
1104683163 12:130766358-130766380 CATTTAATCCTCACTCTGCGAGG + Intergenic
1105395785 13:20032897-20032919 CATGTAATCCAGGCTGGGTGCGG - Intronic
1107593963 13:41942262-41942284 CATTTCATCCTAACTGGAAGTGG - Intronic
1107877496 13:44803650-44803672 CATTTGACCCTCCCTGTGTGGGG - Intergenic
1109278421 13:60327728-60327750 CAGCCAATCCTCACTGGATGTGG - Intergenic
1109778033 13:67069111-67069133 CATTTAATTCTCACTGTTTAAGG + Intronic
1110420967 13:75308047-75308069 CATTTTATCCTCAGGGTGTGCGG - Intronic
1111871821 13:93842929-93842951 CATTTAATTATCTCTGGGTATGG - Intronic
1113365136 13:109668980-109669002 CAGTTAACCTTCACTGGGTGAGG + Intergenic
1116671301 14:47846211-47846233 GATCCACTCCTCACTGGGTGGGG + Intergenic
1118872993 14:69758864-69758886 CATTTATTTCTCACTGGTTCTGG - Intronic
1118935342 14:70282988-70283010 CACTTCATCCTCACCAGGTGAGG + Intergenic
1119152411 14:72373831-72373853 CATTAAATCTTTACTGAGTGGGG - Intronic
1119654335 14:76406347-76406369 CATTTAATCCCCATTGCCTGGGG + Intronic
1120425021 14:84336711-84336733 CATTTTATCCTCACATGGTGGGG - Intergenic
1120903836 14:89601797-89601819 CATCTAATCCTCTCTGGGGCAGG + Intronic
1124814999 15:32981199-32981221 AATTAAATTCTGACTGGGTGCGG + Intronic
1125198648 15:37078121-37078143 CATGTTATTTTCACTGGGTGGGG - Intronic
1126729993 15:51672767-51672789 AATTTACTCCTCACTGAGGGAGG - Intergenic
1129626808 15:77209707-77209729 AATTTTTTCTTCACTGGGTGTGG + Intronic
1129806287 15:78461683-78461705 CATTTCCTGCTCACTGGGTGAGG - Intronic
1130658962 15:85814889-85814911 CACTTAATCCTCACCCTGTGAGG + Intergenic
1131590894 15:93747126-93747148 CAATTCCTCCTCACTGGGTGGGG + Intergenic
1131843105 15:96458942-96458964 CATCTAAGCCTCAGTGGCTGAGG + Intergenic
1131997265 15:98144566-98144588 CTTTTATCCCTCACTGGCTGGGG + Intergenic
1134185769 16:12083911-12083933 AATTTAATCCTCAGTGCCTGCGG + Intronic
1135104162 16:19632881-19632903 CGTTTAGTCCTGACTAGGTGTGG + Intronic
1135402227 16:22174040-22174062 ATTATAATCCTCACTGGGTGCGG + Intronic
1136630142 16:31485175-31485197 CATTTATTCCTCTCTGAGTGGGG + Intronic
1136685552 16:31992522-31992544 TATTTAATGCTGTCTGGGTGAGG - Intergenic
1136786163 16:32936054-32936076 TATTTAATGCTGTCTGGGTGAGG - Intergenic
1136883607 16:33917742-33917764 TATTTAATGCTGTCTGGGTGAGG + Intergenic
1137728825 16:50675028-50675050 CATTTAATCCTCACTGGGTGAGG - Intronic
1140779949 16:78285816-78285838 TATTAAATACTCAGTGGGTGAGG - Intronic
1140930516 16:79623371-79623393 AATTGAATCCTCACTTCGTGTGG + Intergenic
1141702944 16:85650752-85650774 CATTTAATCCTCTCGGAGTGGGG + Intronic
1203088402 16_KI270728v1_random:1197719-1197741 TATTTAATGCTGTCTGGGTGAGG - Intergenic
1147146502 17:38488196-38488218 TATTTAATGCTGTCTGGGTGAGG - Intronic
1147573346 17:41584961-41584983 CATTTCAAACTCACTTGGTGCGG + Exonic
1147889783 17:43709247-43709269 CATTTAATCCTCACTGTGGCTGG - Intergenic
1148397018 17:47317073-47317095 AATACAATCCCCACTGGGTGTGG - Intronic
1149242146 17:54663223-54663245 CCATTCTTCCTCACTGGGTGGGG - Intergenic
1149464880 17:56870129-56870151 CACTAAATCCTCATTGGGTTTGG - Intergenic
1150564433 17:66326104-66326126 CATTTAATCTTCACTAAATGAGG + Intronic
1153972365 18:10238091-10238113 CATTTCATTCTAACTGGGAGAGG + Intergenic
1157162956 18:45331399-45331421 TATTTAATCCTGGCCGGGTGTGG + Intronic
1157665644 18:49484735-49484757 CATTTAATCCTCAATCAGTGAGG + Intronic
1160618137 18:80149353-80149375 AAATTAATGCTCCCTGGGTGTGG + Intronic
926139537 2:10360001-10360023 CATTCATTCTTCACTGTGTGGGG + Intronic
928757561 2:34545394-34545416 CCATTTATCCTCACTGGGCGGGG - Intergenic
929816857 2:45239253-45239275 CATTTAATCCTCACAGTGTCAGG + Intergenic
932868915 2:75376569-75376591 CATATCATCCTCACTAAGTGTGG - Intergenic
932875615 2:75448125-75448147 CATATACTCCTGGCTGGGTGCGG + Intergenic
933191107 2:79335020-79335042 CATTAATTCCTGAATGGGTGTGG - Intronic
933791427 2:85886955-85886977 GATTTAATCCGCACTGCCTGTGG - Intronic
935672523 2:105568019-105568041 CATTTAACTCTCCCTGGGAGGGG - Intergenic
935732002 2:106072213-106072235 CACATAATCCTCAGTTGGTGGGG + Intronic
935821169 2:106894396-106894418 AATTTAATCCTCAGTGGTAGAGG + Intergenic
936011117 2:108925972-108925994 CACTGAACACTCACTGGGTGAGG - Intronic
938912053 2:135895058-135895080 AATTTAGCCCTAACTGGGTGGGG - Intergenic
939100398 2:137889077-137889099 GATTTATGTCTCACTGGGTGAGG - Intergenic
939693330 2:145292888-145292910 CATTTCATTTCCACTGGGTGGGG - Intergenic
940896459 2:159085811-159085833 AATGTAATCCGCACTAGGTGGGG - Intronic
941408720 2:165125605-165125627 ACTTTAATCCTGGCTGGGTGCGG - Intronic
945004745 2:205392587-205392609 TAATTAATCCTAACTGGGTCAGG - Intronic
945728697 2:213505798-213505820 TATATGATCCTGACTGGGTGTGG - Intronic
946657746 2:221966601-221966623 CATATAATATTCACTGGGGGAGG - Intergenic
947609116 2:231511968-231511990 CATTTCATCCTCACTGTGACCGG - Intergenic
947941338 2:234058536-234058558 CAATTGATCCTCACTGTTTGTGG - Intronic
948743872 2:240071065-240071087 AATTTAATCATCACAGGTTGTGG + Intergenic
1169417476 20:5429930-5429952 CATTTAATAATCACGAGGTGAGG + Intergenic
1172023156 20:31929836-31929858 CTTTTTACCCTCACTGGGTGTGG + Intronic
1172594391 20:36140359-36140381 CACTTAATCCTGGTTGGGTGCGG - Intronic
1173776691 20:45714452-45714474 CCATTCCTCCTCACTGGGTGGGG + Intergenic
1178113866 21:29397307-29397329 CCTGTAATCCTCACGGGTTGAGG + Intronic
1181287746 22:21766463-21766485 CATTAAAGCCTCACAGAGTGTGG - Intronic
1181462723 22:23094934-23094956 TATTGAATCCTAACTGGATGCGG + Intronic
1182032008 22:27166720-27166742 CATTGGATCCTCTCTGCGTGAGG - Intergenic
1182681471 22:32083133-32083155 TCTTTAATCCTGACTGGGTTTGG + Exonic
950114152 3:10439504-10439526 CATTTAATCCACAGTCAGTGTGG + Intronic
950954786 3:17040632-17040654 CATTTAATCCTCACATTATGAGG + Intronic
952780341 3:37090903-37090925 CATTTAATACTGACTGAGTTTGG + Intronic
952911910 3:38197401-38197423 CACTTCTTCCTCACTTGGTGTGG + Intronic
953052948 3:39362261-39362283 CAAGTCCTCCTCACTGGGTGGGG + Intergenic
953239616 3:41137187-41137209 CATTGTATCCTCACATGGTGGGG + Intergenic
955023745 3:55146969-55146991 CATGTCATCCTCACAAGGTGAGG - Intergenic
955949163 3:64224906-64224928 CATTTCATCCTCCCTGGAGGTGG - Exonic
955951385 3:64245952-64245974 CATTTAAAAACCACTGGGTGTGG + Intronic
958531915 3:95343524-95343546 TGTTAAATCCTCACTGGTTGTGG + Intergenic
960043533 3:113174354-113174376 CATTTAATCCTCACTCTGTGAGG + Intergenic
960867444 3:122216199-122216221 CATCAAATCCTAACTGGGTGAGG + Intronic
962080689 3:132136325-132136347 CATTTAATCCACACAGAGAGAGG - Intronic
963052917 3:141157879-141157901 CTGTTCCTCCTCACTGGGTGGGG + Intergenic
963142977 3:141962990-141963012 CATTTAATCCTCACAAGGCTGGG + Intronic
964706834 3:159627444-159627466 CATTTAATCCTCACCCTATGAGG + Intronic
965688524 3:171330871-171330893 CATTTACTCTTCTTTGGGTGGGG - Intronic
965954312 3:174349812-174349834 GTTTTAATCCTCAATGGGGGTGG + Intergenic
969546375 4:7831948-7831970 CATTTCATTCTCACTGTGTTGGG - Intronic
973047296 4:45550929-45550951 CCTTTATACCACACTGGGTGGGG + Intergenic
974409477 4:61520995-61521017 AATTTAATCCCCATTGGGTTAGG + Intronic
975191763 4:71472031-71472053 CCTGTAATGCTCACTGTGTGTGG - Intronic
975455850 4:74589040-74589062 CATTTAATCCTGAGAGGCTGAGG + Intergenic
977657251 4:99536445-99536467 CCATTCCTCCTCACTGGGTGGGG - Intronic
980319247 4:131247353-131247375 CATTTAAGCCACCCAGGGTGTGG - Intergenic
980508907 4:133759715-133759737 CCATTCCTCCTCACTGGGTGAGG - Intergenic
989676671 5:43981470-43981492 CCATTCCTCCTCACTGGGTGGGG - Intergenic
990352380 5:54931630-54931652 TATTCACTCCTCACTGGTTGAGG - Intergenic
991773721 5:70063704-70063726 CATTTATTCCTGGCTGGGTATGG + Intronic
991853015 5:70939128-70939150 CATTTATTCCTGGCTGGGTATGG + Intronic
994211732 5:97094778-97094800 CAGCTGATCATCACTGGGTGAGG + Exonic
996508582 5:124294209-124294231 CATGTAATCCTCACATGTTGAGG + Intergenic
999173024 5:149611443-149611465 CATTTAATAAACACTGTGTGTGG + Intronic
999854461 5:155579093-155579115 CATTTAACCCACTCTAGGTGAGG - Intergenic
1001745566 5:174089909-174089931 CATCTCATCCTGGCTGGGTGTGG - Intronic
1003019660 6:2498640-2498662 CATTTGCTCCTCAATGAGTGGGG - Intergenic
1004537800 6:16519692-16519714 CTTTTCATCCTCCCTGTGTGTGG - Intronic
1005213431 6:23496503-23496525 CATTTAATCTTCAGTTAGTGAGG - Intergenic
1005389097 6:25315350-25315372 CATTTACTGCTCACTGTGTGAGG + Intronic
1007456173 6:41978885-41978907 CATATGATCCTGGCTGGGTGGGG + Intronic
1013291192 6:108719989-108720011 CATTAACTCCTCCCTGGCTGTGG - Intergenic
1014846039 6:126278291-126278313 CATTAAATCTTTAGTGGGTGAGG - Intergenic
1015913453 6:138191057-138191079 CATTTAATCCTCACAGGAATTGG - Intronic
1016409606 6:143768124-143768146 AATTTAATCCTAGCTGGGTATGG - Intronic
1018709400 6:166486847-166486869 CGTTTGATCATCACGGGGTGGGG + Intronic
1019618800 7:1979478-1979500 CTTTCAATCCGCACTGGATGGGG + Intronic
1020984158 7:15111355-15111377 CATTTCAGCCTCATTTGGTGTGG - Intergenic
1022721109 7:32942688-32942710 CTTCTAGTCCTCACTGGGTGGGG - Intergenic
1023207198 7:37763681-37763703 CCATTCCTCCTCACTGGGTGGGG + Intronic
1023304822 7:38815101-38815123 TATTTAATTCTCACTGGGAATGG - Intronic
1023382954 7:39626416-39626438 CAGTTAATCCTAAATGGCTGTGG + Intronic
1023595954 7:41829657-41829679 CATTTCTACTTCACTGGGTGCGG + Intergenic
1024094103 7:45970688-45970710 CATTAAAGGCTCACTGGGTTTGG + Intergenic
1028900890 7:96099615-96099637 CATTGAATCCTCACATGGTGAGG + Intronic
1029171783 7:98635408-98635430 AATCTATTCCTGACTGGGTGTGG - Intergenic
1031441164 7:121796222-121796244 CATTTAGAACTGACTGGGTGTGG - Intergenic
1031665238 7:124475379-124475401 AAATCAATCCTGACTGGGTGGGG + Intergenic
1031810533 7:126362421-126362443 CATTTTATCCTCAGTAAGTGTGG - Intergenic
1032397592 7:131601822-131601844 CTTTTGAACCTCACTGGGCGAGG - Intergenic
1032919936 7:136534196-136534218 CCATTCCTCCTCACTGGGTGGGG + Intergenic
1033295628 7:140131662-140131684 TATTTAATCCTCAGAGGTTGGGG - Intronic
1034754229 7:153599821-153599843 GATTTAATCCTCACTGATTGGGG + Intergenic
1036555214 8:9853725-9853747 GATTTAAGCCTCTCTGGGGGTGG - Intergenic
1039087850 8:33797443-33797465 CATTTAATCCTCACAACATGAGG + Intergenic
1041967933 8:63701931-63701953 CACTTAATGCTCACTGGGTGGGG + Intergenic
1047193994 8:122704855-122704877 CATTTGATCCTCAAGGGGAGGGG - Intergenic
1047749790 8:127871666-127871688 CAGATATTCCTCTCTGGGTGTGG - Intergenic
1048025764 8:130585258-130585280 CATTGTATCCTCATTGTGTGAGG + Intergenic
1048546258 8:135390198-135390220 CATTTAATTCTCATTCTGTGAGG - Intergenic
1052183799 9:25564704-25564726 CACTTAATCCTAACTGGCAGTGG + Intergenic
1052480921 9:29024729-29024751 CATGTATTTCTCACTGGGTTAGG - Intergenic
1052719920 9:32162166-32162188 CATTAAATTGTCACTGGTTGGGG + Intergenic
1053259303 9:36647817-36647839 CCTTTAATCCAAACAGGGTGAGG - Intronic
1054353014 9:64035513-64035535 CAATTAATCCAGGCTGGGTGCGG + Intergenic
1054705210 9:68454596-68454618 CATTTAGTCCCCACTGAGTAAGG + Intronic
1055117833 9:72624597-72624619 CATTTCATCCTCACTTGAGGTGG - Intronic
1056756169 9:89383274-89383296 CATGTAGTCCACACTGGGGGTGG - Intronic
1056783880 9:89574001-89574023 AATTGAATCCTGGCTGGGTGAGG - Intergenic
1057452372 9:95176102-95176124 CATTTAATCCTCACAGCCTACGG + Intronic
1057493125 9:95538278-95538300 TATTTGATCCTGGCTGGGTGCGG + Intergenic
1060172402 9:121472757-121472779 CATTTGATCCTCAGCAGGTGGGG - Intergenic
1060340151 9:122768056-122768078 CCATTTATCCTCACTAGGTGGGG + Intergenic
1060873332 9:127060421-127060443 CATTTAATCCTCATTGTAAGAGG - Intronic
1061169241 9:128942544-128942566 CATGGAATCCTCACTCGGAGAGG + Intronic
1187355861 X:18570921-18570943 CATTTTGTCCTCACTCAGTGGGG + Intronic
1187744247 X:22390884-22390906 CTTTAAATCCTCACAGGGTTTGG + Intergenic
1188150218 X:26664949-26664971 CATTTAATGCTCATATGGTGGGG + Intergenic
1192980180 X:76330791-76330813 CAATCCCTCCTCACTGGGTGGGG + Intergenic
1193055006 X:77140748-77140770 CCTATAATCCTCACTTGTTGAGG + Intergenic
1193062385 X:77220345-77220367 CCATCCATCCTCACTGGGTGGGG + Intergenic
1194405703 X:93493879-93493901 CAATTCCTCCTCACTGGATGGGG + Intergenic
1195153428 X:102097481-102097503 CTATTTCTCCTCACTGGGTGGGG + Intergenic
1196228003 X:113189004-113189026 CTGTTCTTCCTCACTGGGTGGGG - Intergenic
1196513743 X:116545984-116546006 CAGTTTCTCCTGACTGGGTGAGG - Intergenic
1196753604 X:119138949-119138971 CATTTATTCCTCACATGCTGGGG - Intronic
1197512697 X:127390290-127390312 CACTTAATCCTCCCTGGCAGTGG - Intergenic
1199297144 X:146172200-146172222 CATTTAACTCACACTGGGTTGGG + Intergenic