ID: 1137731574

View in Genome Browser
Species Human (GRCh38)
Location 16:50693980-50694002
Sequence CTGCTCTCTGTACCTCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137731571_1137731574 -6 Left 1137731571 16:50693963-50693985 CCTGGAGGATCCTGCTGCTGCTC 0: 1
1: 1
2: 1
3: 46
4: 368
Right 1137731574 16:50693980-50694002 CTGCTCTCTGTACCTCTTATGGG 0: 1
1: 0
2: 3
3: 21
4: 238
1137731568_1137731574 28 Left 1137731568 16:50693929-50693951 CCAGTGAGTGGGTGGGTATAAGT 0: 1
1: 1
2: 1
3: 9
4: 103
Right 1137731574 16:50693980-50694002 CTGCTCTCTGTACCTCTTATGGG 0: 1
1: 0
2: 3
3: 21
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137731574 Original CRISPR CTGCTCTCTGTACCTCTTAT GGG Intronic
901111557 1:6800781-6800803 CTGCTCCCTGGGCCTCCTATAGG + Intronic
901288677 1:8104437-8104459 CTGTTCTCGGTACCTCATGTAGG + Intergenic
901798635 1:11694435-11694457 GTGGTCTCTGTGCCTGTTATAGG + Intronic
902673846 1:17994574-17994596 CTCCTCCCTGCACCACTTATTGG - Intergenic
903127585 1:21258368-21258390 CTGCTCTTTGTAACTCTTCTTGG - Intronic
903306505 1:22416844-22416866 CTGATCTCTGTCCCTCTCCTCGG - Intergenic
903532795 1:24044730-24044752 CTGTTCTAGGTACCTCATATAGG + Intergenic
905350483 1:37342911-37342933 CTGCTCTCTGTAACCCCTAGAGG + Intergenic
906481836 1:46204186-46204208 CTACTCTCTGTCCCTGCTATGGG - Intronic
908032285 1:60014302-60014324 CTGTTTTCTGCACTTCTTATGGG + Intronic
910030725 1:82719075-82719097 CTTCACTCTGTACCTCTTCATGG - Intergenic
910350628 1:86293458-86293480 CTTCTCTCTGTGCCTCATTTAGG + Intergenic
910476268 1:87610854-87610876 CAACTGTCTGTACCTCTTAATGG - Intergenic
910681044 1:89864831-89864853 CTTCTTCCTGTACTTCTTATTGG + Intronic
910829436 1:91445409-91445431 CTCCTCTTTGTACCTCTGGTGGG - Intergenic
912698327 1:111857628-111857650 CTCCTCTCTGTTCCTGTTAGGGG + Intronic
917891482 1:179442664-179442686 CTGCTCTCGGTACCTCTTTAGGG + Intronic
917903614 1:179568135-179568157 CTCCTCTTTGTACCTCTGGTAGG + Intronic
918824276 1:189301428-189301450 CTGCACTTTGTACTTTTTATTGG + Intergenic
920044644 1:203125509-203125531 CTGCTCTCTGTGCCTCACAGGGG + Intronic
920625347 1:207592004-207592026 CTCCTCTTTGTACCTCTGGTAGG - Intronic
921202698 1:212822564-212822586 CTGGGCTGTGTACCTCTGATTGG - Intergenic
921648050 1:217643002-217643024 CTGCTCTCTGGACCTCTCAGTGG + Intronic
922451250 1:225739247-225739269 CTGCTCTATCTACCTCCTAAAGG + Intergenic
922976375 1:229787147-229787169 CTTCTTTCTTTAACTCTTATAGG - Intergenic
923619597 1:235567526-235567548 CTCCTCTAGGTACCTCATATAGG + Intronic
1065473851 10:26112621-26112643 CTGCTCTCTCTCTCTCTCATTGG + Intronic
1065634731 10:27719541-27719563 CTCTACTCTGTACCTCTTAATGG - Intronic
1067923577 10:50484455-50484477 CTCCTCTTTGTACCTCTGGTAGG - Intronic
1069480841 10:68780883-68780905 CCTATCTCTGTCCCTCTTATTGG + Intronic
1069579936 10:69559062-69559084 CTGCTCTTTGGGCCTCTTACTGG - Intergenic
1071786910 10:88911338-88911360 CTGCTCTCCCTACCTCCTACTGG - Intronic
1075576492 10:123581426-123581448 CTGCTCCCTCCACCTCTTCTTGG + Intergenic
1075852904 10:125603380-125603402 CTCCCCTCTGCACCTCTTAGTGG + Intronic
1077999103 11:7478831-7478853 CTGCTCTCTGTCTCTCTCCTGGG - Intergenic
1080244021 11:30159295-30159317 CTGCTCTCTGACCCCCTTCTTGG - Intergenic
1080244029 11:30159341-30159363 CTGCTCTCTGACCCCCTTCTTGG - Intergenic
1081113119 11:39161820-39161842 CTGCTCTCTGGTCCTCTCAAAGG + Intergenic
1081229998 11:40574493-40574515 CCAGTCTCTGTAACTCTTATGGG - Intronic
1081516846 11:43840592-43840614 CTACTCTTAGTACCTCATATGGG + Intronic
1083126441 11:60571987-60572009 GTGCTCTCTGTATCTATTTTAGG - Intergenic
1084117778 11:67052041-67052063 CTGGTCTCTGCCCCTCTTACCGG - Intergenic
1086085720 11:82952949-82952971 CTCCTCTTTGTACCTCTGGTGGG + Intronic
1088383061 11:109218295-109218317 CTCCTCTTTGTACCTCTGGTAGG + Intergenic
1088857377 11:113768387-113768409 TGGCTCTCTGTACCTTTTACTGG - Intronic
1089024284 11:115252647-115252669 TTGCTCTCTGAACTACTTATGGG - Intronic
1092736975 12:11592202-11592224 CTGCTCTTTGTTCCTCTTGGTGG - Intergenic
1094057677 12:26283345-26283367 CTGCTCTCTGTTGCCCTTACTGG - Intronic
1094114976 12:26901366-26901388 CTCCTCTCTGTACCTCTGGTAGG - Intergenic
1094403573 12:30089339-30089361 CTGCTCTGTGTGTCTGTTATAGG + Intergenic
1095888501 12:47213494-47213516 CTGATTTCTGGCCCTCTTATAGG + Intronic
1096069311 12:48766167-48766189 CTGTTCTCTGTAGCTGTTCTGGG - Intergenic
1096184795 12:49571670-49571692 CTGCTCACTGTACCTCTTCTTGG + Intronic
1096346480 12:50851580-50851602 TTGCTCTCTGTCCCTCTTTTAGG - Intronic
1099143735 12:79012763-79012785 CTGCTCCCTGTGCCTCTTTCCGG + Intronic
1100143046 12:91642387-91642409 CTTCTCTCTTGGCCTCTTATGGG - Intergenic
1101159601 12:101959948-101959970 CTTCTCCATGTACCTCTCATAGG + Intronic
1103611877 12:122129115-122129137 CTGCTCTCTGTCCCTGTCCTAGG + Exonic
1104121031 12:125800218-125800240 CTGTACTCTGTACCTCTTGGAGG + Intergenic
1105450643 13:20496178-20496200 CTGCTCTGGGTACCTGTTGTAGG - Intronic
1105845921 13:24293738-24293760 CTGCTCTCTGCGCCACTTCTGGG + Intronic
1105848656 13:24315266-24315288 CGGCTCTAGGAACCTCTTATAGG + Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106651223 13:31692219-31692241 CTCCTCTTTGTACCTCTGGTAGG - Intergenic
1107522465 13:41196864-41196886 CTACTCTAGGTACCTCATATAGG + Intergenic
1109072138 13:57783831-57783853 CTCCTCTTTGTACCTCTGGTCGG + Intergenic
1109708954 13:66138959-66138981 ATGCTTTATATACCTCTTATGGG - Intergenic
1110070635 13:71172561-71172583 CTGCTCTCTTTTCCACTTTTCGG + Intergenic
1110709268 13:78632180-78632202 CTGGTCTCTTTTCCTCTTAAAGG - Intronic
1112114613 13:96338509-96338531 ATGCTCTCTCTAACTCTTCTTGG - Intronic
1112680841 13:101763294-101763316 GTGCTCTCTGTAGCACTGATTGG + Intronic
1113592969 13:111513586-111513608 CTGCTGTCTGTAGCTATCATGGG - Intergenic
1115757754 14:36546337-36546359 CTCCCCTCTGTACCTCTTCCTGG + Intergenic
1116055020 14:39852985-39853007 CTGCTCTCTGAACATCACATGGG + Intergenic
1117112064 14:52468023-52468045 CTACTCTATGTACCTCATACAGG - Intronic
1117265084 14:54078399-54078421 CTGCTTTCCTTACTTCTTATAGG - Intergenic
1117465896 14:55993597-55993619 CTGCTATCTGTCCCTATAATTGG + Intergenic
1117659749 14:57991432-57991454 CTGCTCTCTTTTCCTCTTTCAGG - Intergenic
1118678375 14:68213369-68213391 CTGCCATCTGTGCCTCTTATTGG - Intronic
1118879258 14:69812006-69812028 CTGCTCCCAGTACCTCTTTAGGG - Intergenic
1120147799 14:80998784-80998806 CTGCTTTCTTTTCCTCTTCTGGG + Intronic
1120409847 14:84140627-84140649 CTTCTCTCTGTACCTCCTGGAGG + Intergenic
1120521795 14:85533563-85533585 CCGCTCGCTGTACTTCTTTTGGG + Intronic
1122231858 14:100310148-100310170 ATGCCCTCTGGCCCTCTTATTGG + Intergenic
1125355291 15:38811380-38811402 CTTCTCTCTGTAGCTCTTCCTGG - Intergenic
1126170031 15:45687525-45687547 CTCCTGTCTGTATCTCTGATGGG - Intronic
1130936099 15:88472037-88472059 CTGTTGTCTGTACCTGTTGTTGG + Intronic
1133956607 16:10449390-10449412 CTCCTCTTTGTACCTCTGGTAGG + Intronic
1136365836 16:29808857-29808879 CTGCTCCCTTGACCTCTTGTAGG - Intronic
1137731226 16:50691956-50691978 CTGCTCTCTGCACCTCTTAGGGG + Intergenic
1137731574 16:50693980-50694002 CTGCTCTCTGTACCTCTTATGGG + Intronic
1138639094 16:58368612-58368634 CTACTCTAAGTACCTCCTATAGG + Intronic
1138795345 16:59961332-59961354 GTGCCCTCTGTCTCTCTTATTGG - Intergenic
1139317318 16:66084504-66084526 GTTCTCTCTGTACCTCTTTTAGG + Intergenic
1143454000 17:7054041-7054063 TTCCTTTCTGTACCTCTTGTTGG + Intergenic
1143701468 17:8663696-8663718 ATGTTCTCTGTACCTCTTTGTGG + Intergenic
1144724608 17:17495684-17495706 CTGCTCTCTGTGCCCCCTCTAGG - Exonic
1146002253 17:29138418-29138440 CTGCCCTCTGTGCCTCTGAATGG - Intronic
1146620445 17:34393151-34393173 CAGCCCACTGTTCCTCTTATGGG + Intergenic
1148511431 17:48173576-48173598 CTGCTCTCTGTCCAAATTATTGG - Intronic
1149526853 17:57363277-57363299 CTGCTCTAGGAACCTCATATAGG - Intronic
1151315589 17:73320113-73320135 CTGGTATCTGTACCTTTTGTTGG + Intergenic
1151921348 17:77158381-77158403 CTACTCTCGGTACCTCTTATGGG + Intronic
1152351597 17:79786656-79786678 GTGCTTTCTGTTCCTCTGATTGG + Exonic
1153295074 18:3537319-3537341 CTACTCTAGGTACCTCTTATTGG + Intronic
1153766254 18:8377772-8377794 CAGCTCTCTGTACTTCTAAGAGG + Intronic
1153946797 18:10025562-10025584 TTGCTCTAGGTACCTCATATGGG - Intergenic
1154512312 18:15120197-15120219 CTATTCTCTGTACTTGTTATAGG + Intergenic
1156286832 18:35705015-35705037 TTGCTCTCTGTTCCTTTTGTTGG + Intronic
1157337306 18:46750756-46750778 CTCCTCTCTCGACCCCTTATAGG + Intronic
1158537918 18:58324560-58324582 CTGCTCCCTTTACCTCATAGAGG + Intronic
1160327991 18:77968214-77968236 CTTCACTCTGCACCTCTTTTTGG - Intergenic
1164096903 19:22019348-22019370 GTGTTCTCTGTACCTCTGTTAGG - Intergenic
1164813374 19:31175736-31175758 CTGCTCTCTGTTGCTCTGAGTGG + Intergenic
1166936801 19:46338835-46338857 CTGCTCTCTGAACCTCTCTGGGG - Intronic
1167826306 19:51976581-51976603 CTGCTCCCAGTACCTCTTTAGGG - Intronic
1167866399 19:52332106-52332128 CTGCTCCCAGTACCTCTTTAGGG - Intergenic
926170098 2:10547776-10547798 CTGCTCTCTATACATCCTGTTGG + Intergenic
926572907 2:14549075-14549097 CTGCTCTTTGTTCTACTTATAGG - Intergenic
926611040 2:14947495-14947517 CTGATCTCTTTACTTGTTATTGG - Intergenic
926859775 2:17296915-17296937 CTGCTTCCTGTAGCTCTTTTGGG - Intergenic
927119872 2:19948563-19948585 CTGCTGTCTGTTTCTCTTTTAGG - Intronic
927250882 2:20993996-20994018 CTTATCTCTGTACCTGTCATAGG + Intergenic
930332485 2:50003213-50003235 CTCATCTCTGTACCTGTTGTAGG - Intronic
932820448 2:74895243-74895265 CTTCTCTCTCTTCCTCTTGTTGG + Intergenic
933204128 2:79485598-79485620 CTGCTCTCAGTGCCTATCATGGG - Intronic
933715169 2:85354679-85354701 CGGCTCTCCGTACTTCTTTTGGG + Intronic
934453778 2:94076611-94076633 TTGCTCTATGTAGCTTTTATTGG - Intergenic
934983105 2:98863834-98863856 CTACTCTGAGTACCTCATATAGG - Intronic
935106139 2:100045328-100045350 CTGTTTTCTGTGCCTCTTAGAGG - Intronic
937962772 2:127474031-127474053 TTGTTTTCTGTATCTCTTATAGG - Intronic
938812064 2:134862917-134862939 CTCCTCTCTGTCCTTCTTGTTGG - Intronic
938929785 2:136076644-136076666 CTGCTCCCAGTACCTCTTTAGGG + Intergenic
939726760 2:145730209-145730231 CTGCTCTCTTTCCCTCTTCTAGG + Intergenic
941743033 2:169056375-169056397 CTCCCCTCTGTACCTCTGGTAGG - Intergenic
941828169 2:169922662-169922684 CTGCTCTAAGAACCTCATATAGG + Intronic
942421386 2:175811680-175811702 CTGCACTCTCTACCTCTTTTAGG - Intergenic
943819339 2:192300081-192300103 CTGCTCTCTTTTTCTCCTATAGG + Intergenic
945568823 2:211438280-211438302 CTGTTCTCTGTGTCTATTATTGG - Intronic
945816429 2:214610486-214610508 CTGTTCTCTGGAGTTCTTATGGG - Intergenic
946899791 2:224361289-224361311 TTGCTGTCTTTACCTCTTCTGGG + Intergenic
947044350 2:225963174-225963196 TTCCTCTCTGTGCCTCTAATTGG - Intergenic
947096567 2:226573442-226573464 CTGTTCTCTGAAGCTTTTATGGG + Intergenic
1169263832 20:4155816-4155838 CTGCCCTCTGTACCTTCTTTTGG - Intronic
1170077418 20:12434711-12434733 CTTCTCTGTGTGTCTCTTATAGG - Intergenic
1170940734 20:20845972-20845994 CTGCTCTCTGTGCAGCTTACTGG - Intergenic
1171248288 20:23630616-23630638 TTGCTCTCTCTACATCTTTTAGG + Intronic
1171475097 20:25402624-25402646 CTGCTCCCAGTACCTCTTTAGGG + Intergenic
1172563987 20:35913888-35913910 CTGCTCTCCACACCTCTTTTTGG + Intronic
1172758103 20:37301722-37301744 CTGGACTCTGTACTTCTCATGGG - Intronic
1174223755 20:48979557-48979579 CTCCTCTTTGTACCTCTGATAGG + Intronic
1175673075 20:60922596-60922618 TTGCTCTCTGTAACTGTTAGTGG + Intergenic
1177167643 21:17620777-17620799 TTTCTCTCTGTGCCTCCTATTGG - Intergenic
1177540737 21:22491394-22491416 CTACTCTCAGTACCTCATATAGG - Intergenic
1179835576 21:44029920-44029942 CTGACCTCAGTACCTGTTATGGG - Intronic
1181032330 22:20154590-20154612 CTGCTCTCTGCATCTCTGAGTGG + Intergenic
1181715357 22:24723347-24723369 CTGCTGTCTGTTCTTCTTAATGG - Intronic
1182369313 22:29799740-29799762 CAACTCTCTGTCCCTCTGATGGG + Intronic
1182507556 22:30795391-30795413 CTCTTCTCTCTTCCTCTTATGGG + Intronic
1184179294 22:42809194-42809216 CTGCTCTCTCTACATTGTATAGG + Intronic
1185169132 22:49282162-49282184 CTTCTCTCTCTCTCTCTTATCGG - Intergenic
1185310721 22:50152791-50152813 CTGCCCTCTGTTCCTCTCCTGGG - Intronic
952365497 3:32671298-32671320 CTGCTCTCTCTCCCTCTTTTTGG - Intergenic
953244872 3:41181863-41181885 CTTCTCTCTGTACCTCTATGAGG + Intergenic
953725634 3:45395409-45395431 GTGCTCTCTGTTCCTTTTCTGGG + Intronic
954563228 3:51576429-51576451 CTCCTCTTTGTACCTCTAGTAGG + Intronic
955860224 3:63321682-63321704 ATGCTCTCTGTTCCTCCTTTAGG + Intronic
956749821 3:72336732-72336754 GTGCTCTCTGGACCTCTTTCTGG - Intergenic
960964505 3:123095446-123095468 CTGCACCCTGTACTTCTTAAGGG - Intronic
961055285 3:123782655-123782677 CTGGTCTCTTTATCTCTCATCGG + Intronic
961625676 3:128262087-128262109 CTGATCTCTGTAACTGTGATGGG + Intronic
962720943 3:138174483-138174505 GTTCTCTCTGTATCTCTAATTGG - Intronic
963904123 3:150759960-150759982 CTGCTCTCAGAATCTCTCATGGG - Intronic
965141286 3:164838895-164838917 CTACTTTCTTTACCTCTTAGTGG - Intergenic
968614044 4:1569383-1569405 CTGCTCTCTGTGCTTCTGAGAGG + Intergenic
969333252 4:6492177-6492199 CTCCTCTCTGTTTCTCTCATGGG + Intronic
970004472 4:11397288-11397310 CTGCTCTCTGTTCATGATATGGG + Exonic
971088984 4:23317449-23317471 CTGCTCTCTGTCCCTGTTCACGG + Intergenic
972333287 4:38082748-38082770 CTGTTCTCTGTGCCTCTTCCTGG + Intronic
972858682 4:43139806-43139828 CTTCTCTTTGTACCTCTGGTAGG + Intergenic
973013562 4:45107697-45107719 CTCCTCTTTGTACCTCTGGTAGG + Intergenic
973240528 4:47951477-47951499 CTTCTCTCTCTGCCTCCTATTGG - Intronic
973654634 4:53033872-53033894 CTCCTCTTTGTACCTCTGGTAGG - Intronic
974831422 4:67194096-67194118 CTGCTTGCTCTTCCTCTTATGGG - Intergenic
975192060 4:71475993-71476015 CTGTTGGTTGTACCTCTTATTGG + Intronic
975615202 4:76238952-76238974 CTACTCTAAGTACCTCATATAGG + Intronic
976771272 4:88655618-88655640 CTTCTCTCTGTTCATCTTAGAGG + Intronic
976802725 4:89010747-89010769 CTGGTGTCTGTACCTTTGATGGG - Intronic
977059527 4:92239889-92239911 ATGCTCTCTCTAACTCTTCTAGG + Intergenic
977618629 4:99111568-99111590 CTGCTCTTTGAACTGCTTATAGG - Intergenic
977664125 4:99625552-99625574 CTGCTCTCTGAACCCATTATAGG + Intergenic
978236580 4:106468134-106468156 CTCCTCTTTGTACCTCTGGTAGG + Intergenic
980099995 4:128532465-128532487 CTCCTCTTTGTACCTCTGGTAGG + Intergenic
980965472 4:139516606-139516628 CTGCTCATTGAACCTCTTCTTGG - Intronic
981478933 4:145216212-145216234 CTACTCTAGGTACCTCATATGGG + Intergenic
981902596 4:149884310-149884332 GTTCTCTGTGTACCACTTATAGG - Intergenic
982730121 4:158946818-158946840 CTGCTTTCTTTACCTTCTATTGG - Intronic
982866902 4:160524937-160524959 CTGCTCTCATTCTCTCTTATTGG + Intergenic
983170866 4:164534970-164534992 CTGCTCCCTGAACCTCATAAAGG - Intergenic
984973742 4:185211658-185211680 CTGCTCTCTGGAGATCTTATGGG + Intronic
989804928 5:45591552-45591574 TTGCTCTCTGTACATCTTTTTGG + Intronic
992325612 5:75656701-75656723 CTGCTCTCTGGGGCTCTTCTGGG + Intronic
992404693 5:76445904-76445926 CTACTCTTGGTACCTCATATAGG + Intronic
992486489 5:77202007-77202029 CTGCTGTCTCTTCTTCTTATAGG + Intergenic
994089378 5:95795982-95796004 CTGCTCACTGTTCATATTATAGG + Exonic
996676812 5:126185134-126185156 AAGCTTTCTCTACCTCTTATTGG - Intergenic
997067850 5:130583179-130583201 GTCCTCTTTGTACCTCTGATAGG - Intergenic
1000879801 5:166684132-166684154 CTGCTCTCTGTGTCCCTTTTAGG + Intergenic
1001250107 5:170140599-170140621 TTGCTCTCTGAACTTTTTATTGG + Intergenic
1002901897 6:1416591-1416613 CTGCGCTCTGTGCCTCTGGTGGG - Intergenic
1007369787 6:41418904-41418926 ATGTTATCTGTACCTCTCATGGG + Intergenic
1008746500 6:54676159-54676181 CTGCTCTCTCTTCTTCTGATTGG + Intergenic
1008898995 6:56589676-56589698 CTGTTTTCTGCACCTCTTATGGG + Intronic
1009264439 6:61535349-61535371 CTCCTCGTTGTACCTCTTGTAGG - Intergenic
1011659836 6:89584924-89584946 CTAGTCTCTCTTCCTCTTATAGG + Intronic
1012188954 6:96257436-96257458 CTACTCTCAGCACCTCTTCTGGG + Intergenic
1016106876 6:140173916-140173938 CTGCTCACTACACCTCTCATTGG + Intergenic
1016422085 6:143896088-143896110 CTGCTCTCTGCCCCTCTGGTGGG + Intronic
1017687144 6:156924818-156924840 CTGCTCTCTATACTTTTTGTAGG - Intronic
1018852413 6:167650317-167650339 CTGCACTCTGTACCTGTATTCGG - Intergenic
1019648087 7:2141628-2141650 CTTCTCTCTCTCCCTCTAATTGG + Intronic
1019995283 7:4720291-4720313 CTGCTTTCTGTTCTTCTTCTGGG + Intronic
1020474943 7:8583221-8583243 CAGATCTCTGTACCTATTTTGGG - Intronic
1021045541 7:15918594-15918616 CTGCTCTGTGTGTCTCTTATTGG - Intergenic
1021251627 7:18334826-18334848 TTGCTCTCTGAAACTCTAATGGG + Intronic
1022127543 7:27372767-27372789 CTGCTCTCTGGAGTTCTGATGGG - Intergenic
1023523406 7:41072100-41072122 TTGAGCTCTGTACCTCATATTGG - Intergenic
1023797934 7:43809172-43809194 CTGCTCCCAGTACCTCTTTACGG - Intergenic
1024645261 7:51365713-51365735 CTGTTCTCAGTGCCTCCTATTGG - Intergenic
1027193319 7:76010720-76010742 CTGCTCTCTTCCCCTCTTCTGGG - Intronic
1030512456 7:110500434-110500456 CTGCTCTAAGTACCTCATATAGG + Intergenic
1030801664 7:113859825-113859847 CTCCTCTTTGTACCTCTGGTAGG - Intergenic
1033912419 7:146281049-146281071 CTTCTCTCTGTAATTCTTGTAGG - Intronic
1036102159 8:5799321-5799343 CTACTATCTGTACCTCCTACAGG - Intergenic
1036776858 8:11618862-11618884 CTTCTCTCTATCCCTCTTGTTGG + Intergenic
1039308886 8:36294359-36294381 CTGCTCTCTGGACAGCTTGTTGG - Intergenic
1039411346 8:37357738-37357760 CTGCTCTCAGTACCCCTGAAAGG - Intergenic
1041398121 8:57412774-57412796 CTGCTGTTTGTACCTCTAAATGG - Intergenic
1042038365 8:64563378-64563400 CTCCTCTTTGTACCTCTAGTAGG + Intergenic
1043739633 8:83794521-83794543 TTGCTATCTGTACATCTTCTTGG - Intergenic
1044765922 8:95573693-95573715 CTGCTCTCAGTTTCTCTTACTGG - Intergenic
1045662719 8:104454750-104454772 CTTTTCTCTGTACCTCTTCTAGG - Intronic
1047227771 8:122970948-122970970 CTCCTCCCTGTACCTATTTTGGG - Intronic
1048617433 8:136092679-136092701 CAGCTCTCTGTACCAGTTCTTGG + Intergenic
1048786677 8:138057940-138057962 CTGCTTTATGTTCCTTTTATAGG + Intergenic
1052346080 9:27411183-27411205 CTGGTAGCTGTACCTCTTCTAGG + Intronic
1052514078 9:29457378-29457400 CTTCTCTCCTTTCCTCTTATGGG + Intergenic
1056516262 9:87353283-87353305 CTGGTCTCTCTTCTTCTTATAGG - Intergenic
1057362998 9:94392151-94392173 CTGCTCTCTTTCAATCTTATGGG - Intronic
1057546821 9:96025256-96025278 CTGCTCTCTGTCACTCTGGTGGG + Intergenic
1057660343 9:96995948-96995970 CTGCTCTCTTTCAATCTTATGGG + Intronic
1057717467 9:97505849-97505871 CTGCTCTCAGAGCCTCTTAAAGG + Intronic
1059005493 9:110397694-110397716 TGGCTCTCTGTTTCTCTTATTGG - Intronic
1062283724 9:135763663-135763685 CTCTTCTCTGTACCTCTCACTGG + Intronic
1188262948 X:28039587-28039609 CTACTGTCTGTCCCTCTTGTGGG - Intergenic
1188970975 X:36614639-36614661 TTGCTCTCTCTCCCTCTTTTGGG - Intergenic
1191652178 X:63551317-63551339 CTCCTCTTTGTACCTCTGCTAGG + Intergenic
1197270925 X:124423964-124423986 CTGGTATCTCTTCCTCTTATTGG - Intronic
1198535009 X:137576322-137576344 CTGGGCTCTGTAGCTCTTAAAGG - Intronic
1199783544 X:151084014-151084036 ATGCCCTCTGCCCCTCTTATGGG + Intergenic
1200413725 Y:2887069-2887091 CTGCTCCCAGTACCTCTTTAGGG + Intronic
1201692952 Y:16789520-16789542 CTGAACCCTGTACCTCTTAAAGG + Intergenic
1201741811 Y:17332166-17332188 CTGCTCTCAGTACCTCTTTAAGG - Intergenic