ID: 1137738258

View in Genome Browser
Species Human (GRCh38)
Location 16:50741317-50741339
Sequence TTCCCAAGGATGGTGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137738258_1137738263 -5 Left 1137738258 16:50741317-50741339 CCCTTCTTCACCATCCTTGGGAA No data
Right 1137738263 16:50741335-50741357 GGGAAAATTCCCTCCAAACTGGG No data
1137738258_1137738262 -6 Left 1137738258 16:50741317-50741339 CCCTTCTTCACCATCCTTGGGAA No data
Right 1137738262 16:50741334-50741356 TGGGAAAATTCCCTCCAAACTGG No data
1137738258_1137738270 17 Left 1137738258 16:50741317-50741339 CCCTTCTTCACCATCCTTGGGAA No data
Right 1137738270 16:50741357-50741379 GATAGGTGGCAACAGAGGTTCGG No data
1137738258_1137738269 12 Left 1137738258 16:50741317-50741339 CCCTTCTTCACCATCCTTGGGAA No data
Right 1137738269 16:50741352-50741374 ACTGGGATAGGTGGCAACAGAGG No data
1137738258_1137738265 3 Left 1137738258 16:50741317-50741339 CCCTTCTTCACCATCCTTGGGAA No data
Right 1137738265 16:50741343-50741365 TCCCTCCAAACTGGGATAGGTGG No data
1137738258_1137738264 0 Left 1137738258 16:50741317-50741339 CCCTTCTTCACCATCCTTGGGAA No data
Right 1137738264 16:50741340-50741362 AATTCCCTCCAAACTGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137738258 Original CRISPR TTCCCAAGGATGGTGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr