ID: 1137739391

View in Genome Browser
Species Human (GRCh38)
Location 16:50752733-50752755
Sequence TTCTAGGCTCCTCATAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137739386_1137739391 25 Left 1137739386 16:50752685-50752707 CCTCTGCTAACCACAATTTCTTC 0: 1
1: 0
2: 2
3: 33
4: 310
Right 1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG 0: 1
1: 0
2: 4
3: 37
4: 299
1137739385_1137739391 29 Left 1137739385 16:50752681-50752703 CCAACCTCTGCTAACCACAATTT 0: 1
1: 0
2: 13
3: 171
4: 1176
Right 1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG 0: 1
1: 0
2: 4
3: 37
4: 299
1137739384_1137739391 30 Left 1137739384 16:50752680-50752702 CCCAACCTCTGCTAACCACAATT 0: 1
1: 7
2: 50
3: 613
4: 2302
Right 1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG 0: 1
1: 0
2: 4
3: 37
4: 299
1137739387_1137739391 15 Left 1137739387 16:50752695-50752717 CCACAATTTCTTCTGATTTCTCT 0: 1
1: 0
2: 5
3: 69
4: 842
Right 1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG 0: 1
1: 0
2: 4
3: 37
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137739391 Original CRISPR TTCTAGGCTCCTCATAAGAG TGG Intronic
900426135 1:2580004-2580026 TTGTAGGCTCCTCATAGAAGTGG - Intergenic
901757468 1:11449995-11450017 CTCTAGGGACCTCATAAGAATGG - Intergenic
904080027 1:27866396-27866418 CTCTAGGTTCCTCATCTGAGTGG + Intergenic
906184088 1:43847556-43847578 CTCTAGGCACCTCATATGAATGG - Intronic
907464181 1:54624149-54624171 TTCTGGGGTCCTCAGAATAGGGG - Intronic
907931447 1:59004838-59004860 CTCTAGGCTCCTCATAGGAGTGG - Intergenic
908475619 1:64484699-64484721 CTCTAGGTACCTCATAAAAGTGG + Intronic
909005665 1:70273364-70273386 TTTTAGGCTCCTCACTAAAGTGG - Intronic
909372813 1:74905242-74905264 TTCTAGGTAACTCATATGAGTGG + Intergenic
910996406 1:93108886-93108908 GTCTAGGCACCTCATATAAGTGG + Intronic
911203935 1:95074114-95074136 TTCTAGGCTCCAGGTAAGTGTGG - Intergenic
911391055 1:97243983-97244005 TTCTAAGCTCCTCATAAATTTGG - Intronic
911633291 1:100206620-100206642 TTTTAGGCTTCTCATAACATTGG - Exonic
913141122 1:115942395-115942417 TTTTAGGCTTCTCATGACAGTGG + Intergenic
915378766 1:155422078-155422100 TTCCAGGTTCCTCATACTAGTGG + Intronic
915587733 1:156853247-156853269 TTCTATGTTCCTAATCAGAGTGG - Intronic
916345493 1:163786311-163786333 TTCTTTGCTCCAGATAAGAGTGG + Intergenic
916693587 1:167214781-167214803 GTCTAGGCTCAGCATAAGAAAGG + Intergenic
916933942 1:169608427-169608449 CTCTAAGTTCCTCATATGAGTGG + Intronic
918321948 1:183372966-183372988 TTCTAGGCTCCACATAGGAGGGG + Intronic
918542429 1:185647061-185647083 TTCTAAGCTCCTAAAAACAGGGG + Intergenic
918817236 1:189203505-189203527 TTCTAGGTACCTCATATAAGCGG - Intergenic
919044173 1:192430556-192430578 TTCTAGGCTTCTGATAGGAGGGG - Intergenic
920625844 1:207598017-207598039 TTTTTGGCACCTCATAAAAGTGG - Intronic
921365417 1:214369066-214369088 TTCTAGGAACCTCATATAAGTGG + Intronic
922032404 1:221813935-221813957 TTCTAGGTCCCAGATAAGAGAGG + Intergenic
922111917 1:222567220-222567242 TTCTAGGTACCTCATATAAGTGG - Intronic
923754717 1:236781255-236781277 TTCTAGGTACCTCATATAAGTGG - Intergenic
924039293 1:239967907-239967929 TTCTAGGTTCCTCATACATGTGG - Intergenic
924632750 1:245757203-245757225 TTCTAGGTACCTCATATAAGTGG + Intronic
1063364504 10:5481537-5481559 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
1063477212 10:6339859-6339881 TTCTAGGGACCTCATGGGAGTGG - Intergenic
1064833076 10:19493231-19493253 TTCTAGGTACCTCATATCAGTGG + Intronic
1065631904 10:27689231-27689253 TTCTTGGCTCTTCACAAGAGCGG + Intronic
1065633422 10:27706096-27706118 TTCTAGGTACCTCATACAAGTGG + Intronic
1066291120 10:34015254-34015276 GTCTAAGGTCCTCATAAGGGTGG + Intergenic
1069574965 10:69520234-69520256 TTCTAGGCTCCACACAAGAATGG + Intergenic
1071241048 10:83705416-83705438 TTTTACGTTCCTCATACGAGTGG + Intergenic
1071280029 10:84093023-84093045 TTCTGTGCTCCTCCTGAGAGAGG - Intergenic
1071499345 10:86192458-86192480 TTCTAGGGGCCTCATATAAGTGG - Intronic
1073128143 10:101165427-101165449 TTCTAGGTACCTCATAAAAGTGG + Intergenic
1073648921 10:105337998-105338020 TTCTAGGTACCTCATGAAAGTGG - Intergenic
1075360275 10:121826088-121826110 TTCTAGGTACCTCAAAAAAGTGG - Intronic
1076392821 10:130116400-130116422 TTCTAGGCAGCTCATATAAGTGG - Intergenic
1079028014 11:16964035-16964057 TTCTAGGTATCTCATAAAAGTGG + Intronic
1080288898 11:30648464-30648486 TTCTAGGTACCTCATATAAGTGG + Intergenic
1085014125 11:73161361-73161383 TTCTAGGTACCTCATATAAGTGG + Intergenic
1085525886 11:77163318-77163340 TTCTAGGTACCTCATATAAGTGG + Intronic
1086337804 11:85816404-85816426 TTCTAGGTACCTCATATAAGTGG - Intergenic
1086587486 11:88472043-88472065 TTATAGGCGCCTCATAATAGAGG - Intergenic
1087210575 11:95442878-95442900 TTCTAGGCTTCACAGAGGAGGGG + Intergenic
1087529597 11:99361702-99361724 TTCTAGGTTCCTCATATAAGTGG + Intronic
1087629501 11:100634021-100634043 TTCTAGGCACCTCATGTAAGTGG + Intergenic
1090365860 11:126204915-126204937 TTCTAGGTACCTCACATGAGTGG + Intronic
1091606148 12:1953099-1953121 TTCTGGGTTCCTCATAGGACAGG + Exonic
1092207531 12:6624494-6624516 TTCTAGATACCTCATATGAGTGG + Intronic
1092727034 12:11496973-11496995 TTCTAGGCACCTCACATAAGTGG + Intronic
1093787238 12:23206895-23206917 TTATAGGCTCCTAATAAAAATGG + Intergenic
1093956682 12:25228534-25228556 TTTTAGGTTCCTCATATAAGTGG - Intronic
1097158013 12:57026785-57026807 TCCTAGGCTCCAGAAAAGAGAGG + Intronic
1098181873 12:67855932-67855954 TTCTAGTCTCCTCCCCAGAGAGG + Intergenic
1098253988 12:68597967-68597989 CTCTAGGTACCTCATATGAGTGG + Intergenic
1099497401 12:83366927-83366949 TTTTAGGCTGATCTTAAGAGAGG - Intergenic
1099974038 12:89527872-89527894 TTCTAGGTACCTCATATGAATGG - Intergenic
1100258459 12:92908248-92908270 TTCTAGGTACCTCATATAAGTGG - Intronic
1100276873 12:93079676-93079698 TTCTAGGCACCTCATATAAGTGG - Intergenic
1100365265 12:93914795-93914817 CTCTAGGTACCTCATATGAGTGG - Intergenic
1100625689 12:96329068-96329090 TTCTAGGTACCTCATATGAGTGG - Intronic
1101115754 12:101529752-101529774 TCCTAGGCTCTTCAGAAGACAGG + Intergenic
1101338572 12:103819994-103820016 TTCTAGGAACCTCATAGAAGTGG + Intronic
1101513457 12:105413075-105413097 TTCTAGGTACCTCATATGAGTGG + Intergenic
1101668151 12:106839462-106839484 TTTTAAACTCCTCATAAAAGTGG - Intronic
1101930974 12:109013905-109013927 CTCTAGGCACCTCATATAAGTGG + Intronic
1102930115 12:116855767-116855789 TTCTAGTCTCATCCTAAGAATGG - Intergenic
1103297600 12:119901386-119901408 TTTTAGGCACCTCATATAAGTGG + Intergenic
1106331359 13:28742543-28742565 TTCTAGGTACCTCATATAAGTGG + Intergenic
1107253527 13:38394651-38394673 TTCTAGCATCCTCATAATAGAGG - Intergenic
1107473826 13:40715722-40715744 TTCTAGGTTCCTCACATAAGTGG + Intergenic
1107640462 13:42437969-42437991 CTCTAGGTACCTCATATGAGTGG + Intergenic
1107809837 13:44189619-44189641 TTCTAGGCTCCTCAGATGGGTGG + Intergenic
1108046743 13:46390489-46390511 TTCTAGGCTCCTCATGCAAGTGG - Intronic
1108637985 13:52354894-52354916 TTCCAGGTACCTCATATGAGTGG + Intergenic
1110607212 13:77446859-77446881 TTCTAGCCTCATCCTAAGAGGGG - Intergenic
1112411218 13:99165252-99165274 TTCTAGGAACCTCATATAAGTGG - Intergenic
1112412765 13:99178249-99178271 TTCTGGGCACCTCATATAAGTGG + Intergenic
1114682993 14:24502625-24502647 TTTGGGGCTCCTCATAACAGTGG + Intronic
1114740035 14:25087124-25087146 TTCTAAGCTCCTCAAAAGCAGGG + Intergenic
1115823286 14:37235806-37235828 TTCTAGGGACCTCATATAAGTGG + Intronic
1117146131 14:52838411-52838433 CTCTAGGCACCTCATAGAAGTGG + Intergenic
1117262879 14:54054948-54054970 TTCTAGGTACCTCATATGAGTGG - Intergenic
1118493161 14:66281508-66281530 TTCTCGGCTTCTCAGAAGACAGG - Intergenic
1119561855 14:75596849-75596871 TTCTAGGATCCTTGTAAAAGTGG + Intronic
1119881867 14:78106069-78106091 TTCTAGGCTGCTCACAAGGCTGG + Intergenic
1120089052 14:80309978-80310000 TTGTAGGCTAATCATGAGAGGGG + Intronic
1121300691 14:92868312-92868334 TTCTAGGTACCTCATATAAGTGG - Intergenic
1121588434 14:95080111-95080133 TTCTTGGCTCCTCATAGTAAAGG + Intergenic
1124432856 15:29621987-29622009 GTCTAGGCACCTCATATAAGTGG - Intergenic
1126461666 15:48921232-48921254 GTCTAGGTACCTCATAAAAGTGG - Intronic
1126655573 15:50973636-50973658 TTTTAGGTACCTCATAAAAGTGG + Intronic
1127331712 15:57946336-57946358 CTCTAGGCACCTCATACAAGTGG + Intergenic
1127390568 15:58501974-58501996 TTCTAGCCTCCCCAGGAGAGTGG - Intronic
1127543123 15:59963012-59963034 TTTTAGGCACCTCATATAAGTGG - Intergenic
1127593949 15:60458881-60458903 TTCTAGGTTCCCCATATAAGAGG - Intronic
1127929581 15:63583696-63583718 TTCTAGGCACCTCATATAAGTGG + Intronic
1128140223 15:65294643-65294665 TTCTAGGTGCCTCATATAAGTGG - Intronic
1128287350 15:66448244-66448266 CTCTAGGTACCTCATATGAGTGG + Intronic
1128585441 15:68845425-68845447 TTCTAGGCACCTCAGATGAGTGG + Intronic
1131018857 15:89080872-89080894 TTCTAGGCACCTCATGTAAGTGG + Intergenic
1131451318 15:92542594-92542616 TTCTAGGTACCTCATATAAGTGG - Intergenic
1132208531 15:100003145-100003167 CTCGAGTCTCCCCATAAGAGAGG + Intronic
1133388997 16:5393938-5393960 TTCTCGGCACCTCATATAAGTGG + Intergenic
1133972787 16:10579601-10579623 TTCTAGGTGTCTCATAAAAGTGG + Intronic
1136492634 16:30619679-30619701 TTCTAGGCTGCTTTTAATAGTGG + Intronic
1136615055 16:31393485-31393507 GCCTCAGCTCCTCATAAGAGTGG - Intronic
1137030663 16:35521202-35521224 TTCTAGGGTGCTCTTAATAGTGG - Intergenic
1137061727 16:35796533-35796555 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
1137255922 16:46775480-46775502 TTCTAGGTACCTCATATAAGTGG - Intronic
1137683399 16:50369660-50369682 TTATAGTCTCCTCTTAAGAAAGG + Intergenic
1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG + Intronic
1137963145 16:52905751-52905773 CTCTAGGTACCTCATATGAGTGG - Intergenic
1138395374 16:56700244-56700266 TTCTAGGCACCTCATGTAAGTGG - Intronic
1139022475 16:62767566-62767588 TCCTAGGCTCCTAATATGATGGG + Intergenic
1146023110 17:29295530-29295552 TTCTAGGTACCTCATATAAGTGG + Intergenic
1146129425 17:30258599-30258621 TTCTGGGCTCCTTAGTAGAGGGG - Intronic
1146549728 17:33769891-33769913 GACTAGAGTCCTCATAAGAGAGG - Intronic
1147482402 17:40779195-40779217 TTTTAGCCTCCACATATGAGTGG + Intronic
1147738776 17:42658492-42658514 CTCTAGGCACCTGATATGAGTGG - Intergenic
1148807724 17:50272635-50272657 TTCTAGTCTCCTGATCCGAGGGG - Intronic
1149166991 17:53763815-53763837 TTTTAGATACCTCATAAGAGTGG + Intergenic
1149603169 17:57906380-57906402 TTCTAGGTTCCTCATATAAGTGG - Intronic
1150963636 17:69941565-69941587 TTCTAGAATCCTCATAAAAATGG + Intergenic
1153319806 18:3761307-3761329 CTCTAGGCACCTCATATAAGTGG + Intronic
1153358696 18:4168617-4168639 CTCTAGGGACCTCATAAAAGTGG + Intronic
1153559000 18:6351287-6351309 TTCTAGGTACCTCATATAAGTGG - Intronic
1153570287 18:6465168-6465190 TTCTAGACTCCTCATATAAGTGG + Intergenic
1154000863 18:10481459-10481481 TTCTAGGTGCCTCATCTGAGGGG - Intronic
1154391804 18:13943479-13943501 TTCTGGGCACCTCATATAAGTGG - Intergenic
1155118599 18:22795557-22795579 TTCTAGGTACCTCATATAAGGGG - Intergenic
1158156668 18:54433378-54433400 TTCTAGGTACCTCATATAAGTGG + Intergenic
1158480850 18:57820627-57820649 TTCTAGGGACCTCACAAAAGTGG - Intergenic
1158718466 18:59900686-59900708 TTCTAGGCTCCTGAACACAGGGG - Intronic
1158886345 18:61830447-61830469 TTCCAGGTACCTCATAAGAGTGG + Intronic
1160531707 18:79569006-79569028 TGCCAGGCTCCTGATAAGATTGG + Intergenic
1161694815 19:5760516-5760538 CTCTAGGGTCCTCCTAGGAGTGG - Intronic
1161695260 19:5763572-5763594 CTCTAGGGACCTCCTAAGAGCGG - Intronic
1162601189 19:11671048-11671070 TTCTAGGCACCTCATATAACGGG + Intergenic
1162764345 19:12909291-12909313 TTCTTGGGTCCTCAGGAGAGAGG - Intronic
1165007733 19:32820176-32820198 TTCTGGGCCCCTCAGAAGACAGG + Intronic
1165345566 19:35247224-35247246 TTCTAGGTGCCTCATATAAGTGG - Intergenic
1165617433 19:37214378-37214400 TTCTAGGCACCTCATATAAGTGG + Intronic
1167852054 19:52209721-52209743 TTCTAGATTCCTCATATAAGTGG + Intronic
1167945813 19:52987741-52987763 TTCTAGGGTACTCTTAATAGTGG + Intergenic
926713436 2:15902822-15902844 TTCTAGGTACCTCATATAAGTGG - Intergenic
928982727 2:37153549-37153571 TTCTAGGTACCTCATATAAGTGG + Intronic
929301640 2:40310227-40310249 TCCAAGGCTCGTCATAAGACTGG - Intronic
929715890 2:44309276-44309298 TTCTAGGTACCTCATATAAGTGG + Intronic
929906819 2:46053568-46053590 TTCTAGGTACCTCATGTGAGCGG + Intronic
930213448 2:48668113-48668135 TTCTAGGTACCTCATATAAGTGG + Intronic
930213561 2:48669246-48669268 TTCTAGGTGCCTCATATAAGTGG + Intronic
930814400 2:55577988-55578010 TTACAGCATCCTCATAAGAGAGG + Intronic
930889022 2:56361572-56361594 TTCAAGTCTCCTCAGATGAGAGG - Intronic
931689728 2:64825137-64825159 TTCTAGGCATCTCATATAAGTGG - Intergenic
934676862 2:96255525-96255547 TTCTAGGTATCTCATATGAGTGG - Intronic
935420588 2:102865076-102865098 TTATAGACTCCTCAGAAGAATGG - Intergenic
935637464 2:105260516-105260538 TTCTAGGTGTCTCATAAAAGTGG - Intergenic
935711951 2:105907028-105907050 TTCTAGGTACCTCATAGAAGTGG + Intergenic
937963094 2:127478325-127478347 TTCTAGGTACCTCATATAAGTGG - Intronic
938158160 2:128958973-128958995 TGCTAGTATCCTCATAAGAGAGG + Intergenic
938760011 2:134416354-134416376 TTCTAGGTACCTCATATAAGTGG + Intronic
939541783 2:143503104-143503126 TTCTAGGCTGGTCATAACGGGGG - Intronic
941692158 2:168512103-168512125 TTCTAGGTACCTTATATGAGTGG - Intronic
942153749 2:173105682-173105704 TTCTAGGTACCTCATATAAGTGG - Intronic
942948626 2:181697419-181697441 TTCTAGGTACCTCATATAAGTGG + Intergenic
943315966 2:186387460-186387482 TTCTAGGTGCCTCATACAAGTGG - Intergenic
943888234 2:193250590-193250612 TTCTAGATACCTCATAAAAGTGG - Intergenic
944185268 2:196941041-196941063 CTCTAGGTACCTCATATGAGTGG - Intergenic
944652821 2:201848617-201848639 TTCTAGGTACCTCATATAAGTGG + Intronic
944905719 2:204260195-204260217 TTCTAGGCTTCTTCTAGGAGGGG + Intergenic
1168783117 20:511548-511570 TTCTAGGAACCTCATATAAGTGG + Intronic
1168980594 20:2000381-2000403 TTCTAGGTACCTCATAGAAGTGG - Intergenic
1169341880 20:4802589-4802611 CTCTAGGTACCTCATAAAAGTGG - Intronic
1169370342 20:5024044-5024066 CTCTAGGCACCTCATACAAGTGG + Intergenic
1171353159 20:24521033-24521055 TTCTAGGTACCTCATATAAGTGG + Intronic
1173578202 20:44126728-44126750 TTCTGGGCTCCACATAGCAGGGG - Intronic
1174285913 20:49473464-49473486 TTCTAGGTACCTCATATAAGTGG - Intronic
1174377318 20:50134671-50134693 TTCTGGGCTCCTGATGAGATGGG + Intronic
1178638690 21:34328331-34328353 TTGAAGGCTCCTCAAAAGACGGG + Intergenic
1178756397 21:35354192-35354214 ATCTAGGTGCCTCATAAAAGTGG + Intronic
1179405159 21:41119741-41119763 TTCTAGGGACCTCATAGAAGTGG + Intergenic
1181541757 22:23576961-23576983 TTCTAGGTACCTCATAGAAGTGG + Intronic
1181551980 22:23644831-23644853 TTCTAGGTACCTCATAAAAGTGG + Intergenic
1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG + Intergenic
1182507749 22:30797064-30797086 TTCTAGGTACCTCATATAAGTGG + Intronic
1183639850 22:39086273-39086295 TTCTAGGCTCCACATAAACACGG + Exonic
950418182 3:12880722-12880744 TTCTAGGTACTTCCTAAGAGTGG + Intergenic
950514790 3:13457685-13457707 TTCTAGGGACCTCATAAAAGTGG - Intergenic
951103576 3:18717403-18717425 TTCTAGGCCCTTCATCAGAGGGG - Intergenic
951740828 3:25921421-25921443 TTCTTGGCTCTTCCAAAGAGTGG + Intergenic
952292321 3:32029483-32029505 TTCTTGCCTCCTCAGAAGAAAGG - Intronic
953571304 3:44073797-44073819 CTCTAGGAGCCTCATATGAGTGG - Intergenic
955136578 3:56224954-56224976 TTCTTGGCCTCTGATAAGAGGGG + Intronic
956919628 3:73913263-73913285 TTCTAGGTGCCTCAGATGAGTGG + Intergenic
957073737 3:75585066-75585088 TCCAAGGCACCTCAAAAGAGGGG + Intergenic
957404298 3:79756875-79756897 TTCTAGGTACCTCATATAAGTGG + Intronic
957802933 3:85108462-85108484 TTCTAGGTACCTCATAGAAGTGG - Intronic
958959721 3:100497623-100497645 TTCTAGGTACCTCATATAAGTGG + Intronic
961021398 3:123510214-123510236 TTCTAGGTACCTCATATAAGTGG + Intronic
961456232 3:127025664-127025686 CTCTAGGGACCTCATATGAGTGG + Intronic
963753315 3:149205663-149205685 TTCTAGGCAACTCATACAAGTGG - Intronic
964854250 3:161129070-161129092 TTCTAGGTACCTCATATAAGCGG - Intronic
965505390 3:169509576-169509598 TTCTAGGCCTCTCATGAAAGTGG + Intronic
966263406 3:178007462-178007484 TTCTAGGTTCCTCATATAAGTGG + Intergenic
966427611 3:179796698-179796720 TTCTGGTCTCCTCATAAAATAGG + Exonic
973038219 4:45435508-45435530 TTGAAGGCTCCTAAAAAGAGAGG + Intergenic
973691122 4:53433349-53433371 TTCTAGGTACCTCATATAAGTGG + Intronic
973823056 4:54679935-54679957 TTCTAGGTACCTCATATAAGTGG - Intronic
973992768 4:56426964-56426986 TTCTAGGTACCTCATATAAGTGG + Intronic
979718295 4:123868263-123868285 TTCTAGGTACCTCATATAAGTGG - Intergenic
981964234 4:150581643-150581665 TTCTTTGCTACTGATAAGAGAGG + Intronic
982269611 4:153572925-153572947 TTCTAGGTCCCTCATAGAAGTGG + Intronic
982361784 4:154526254-154526276 CTCTAGGTTCCTCATATGAGTGG - Intergenic
984879387 4:184397262-184397284 TTCTAGGTACCTCCTATGAGTGG - Intronic
984914065 4:184704707-184704729 TTCTGGGTACCTCATATGAGTGG - Intronic
984937945 4:184905849-184905871 TTCTAGGTGCATCATATGAGTGG + Intergenic
984946445 4:184972263-184972285 TTCTAGGAACCTCATATGAGTGG + Intergenic
985372018 4:189295697-189295719 TTCTATGCTCATCACATGAGAGG + Intergenic
986439190 5:7763639-7763661 TTCTAGGGACCTCACATGAGTGG + Intronic
986973789 5:13371243-13371265 TTCTAGGTACCTCATATAAGTGG - Intergenic
986977129 5:13408050-13408072 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
988821903 5:34895585-34895607 TCCTTTTCTCCTCATAAGAGGGG + Intronic
989160111 5:38382792-38382814 CTCTTGGCTCCTCATATCAGTGG - Intronic
989464138 5:41735369-41735391 TTCTAGATACCTCATATGAGTGG - Intronic
989672425 5:43934684-43934706 TTCTAGGCTCCCCACAAGACAGG + Intergenic
990335739 5:54770734-54770756 CTCTAGGCACCTCATATAAGTGG - Intergenic
990429602 5:55721504-55721526 TTCTAAGCTCTTAATAAAAGAGG + Intronic
991656264 5:68906642-68906664 TTCTAGGTACCTCATATAAGTGG + Intergenic
991686345 5:69185726-69185748 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
992587970 5:78260828-78260850 TTCTAGGTACCTGATAAAAGTGG + Intronic
992853167 5:80832179-80832201 TTCTAGGCATCTCATATAAGTGG - Intronic
993594662 5:89838093-89838115 TTGCAGGCTCTTCATAAGATAGG + Intergenic
994385916 5:99131494-99131516 CTCTAGGTGCCTCATATGAGGGG + Intergenic
995693770 5:114857299-114857321 TTCTAGGCTCCTTTTATGTGTGG - Intergenic
996266802 5:121550838-121550860 TTCTATGCTTCTCAGCAGAGAGG + Intergenic
996842547 5:127863476-127863498 TTCTAGGTACCTCATATAAGTGG - Intergenic
997260464 5:132462015-132462037 TTCTAGGTACCTCATATAAGTGG - Exonic
997494381 5:134309696-134309718 TTATAGAATCCTCAGAAGAGTGG - Intronic
999446411 5:151643646-151643668 CTCTAGGCACCTCATAGAAGCGG + Intergenic
999706639 5:154278763-154278785 TTCTAGGTACCTCATATAAGTGG + Intronic
1000212835 5:159123920-159123942 ATCTAGGCACCTCATACAAGTGG + Intergenic
1000514647 5:162225176-162225198 TTGTAAGCTTCTAATAAGAGGGG + Intergenic
1001538040 5:172513425-172513447 TTCTAAGCTCCTTATATGATGGG - Intergenic
1002819260 6:708909-708931 TTCTAAACTGCTCAGAAGAGTGG + Intergenic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1004029971 6:11858722-11858744 TTCTAGGTACCTCATATAAGTGG - Intergenic
1004200631 6:13544460-13544482 TTCTAGGTTCCTCATATAAGTGG + Intergenic
1004219576 6:13734551-13734573 GTCTAGGTTCCTCATATAAGTGG - Intergenic
1004429926 6:15534105-15534127 CTCTAGGTACCTCATATGAGTGG - Intronic
1004518748 6:16342796-16342818 TTCTAGATTCCTCATAGAAGGGG - Intronic
1005218567 6:23560299-23560321 TTCTTGCCTCCTCAGAAGAAAGG - Intergenic
1006096118 6:31657861-31657883 TTCTGGGCTACTCAAAAGAGAGG + Intronic
1006476891 6:34261518-34261540 TTCTAGGTACCTCATATGAGTGG - Intergenic
1007887350 6:45245503-45245525 TTCTAGGTACCTCATATAAGTGG + Intronic
1008713010 6:54252625-54252647 CTCTGGCCTCCTCATAGGAGTGG + Intronic
1009213947 6:60896840-60896862 TTCTAGGTACCTCATATAAGTGG + Intergenic
1009657990 6:66570190-66570212 TTCTTGCCTCCTCAGAAGAAAGG - Intergenic
1009994497 6:70883491-70883513 TTCTAGGTACCTCATATAAGTGG - Intronic
1010321358 6:74514058-74514080 TTCTAGATTCCACATAAGTGGGG - Intergenic
1013005319 6:106067643-106067665 TTCTAGGTACCTCATAGAAGTGG - Intergenic
1013582412 6:111549396-111549418 TTCTAGGCTGCTCTTTAGAAAGG + Intergenic
1013632013 6:111995079-111995101 TTCTACGTACCTCATAAAAGCGG - Intergenic
1014165261 6:118217401-118217423 TTCTAGGTACCTCATACAAGTGG - Intronic
1014428441 6:121337559-121337581 TTCAGAGCTCCTCATAAGATTGG + Intergenic
1015143958 6:129965140-129965162 TTCTAGGCACCTCATGTAAGTGG - Intergenic
1016367120 6:143331423-143331445 TTCTAGGTACCTCATATAAGTGG + Intronic
1016941127 6:149483548-149483570 TTCTAGGCAGCTCTTAGGAGTGG + Intronic
1017428217 6:154344081-154344103 CTCTAGCCTCCTCATAAAACTGG + Intronic
1017500793 6:155020946-155020968 TTCTAGGCACCTCATATAAGTGG + Intronic
1018034351 6:159868616-159868638 TTCTAGGTTCCTCATGCAAGTGG - Intergenic
1018040359 6:159916266-159916288 CTCTAAGCCCCTCATATGAGTGG - Exonic
1019078266 6:169409210-169409232 CTCTAGGGACCTCATAAAAGTGG + Intergenic
1020680414 7:11229971-11229993 TTCTAGGTACCTCATATAAGTGG + Intergenic
1022041306 7:26584059-26584081 TCCTAGGCACCTCATATAAGTGG - Intergenic
1023762143 7:43474905-43474927 TTCTAGGTTCCTCATATGAGTGG - Intronic
1023787744 7:43724823-43724845 TTCTAGGGTCCTCATAAAAGTGG - Intronic
1028998827 7:97130753-97130775 TTCCAGTCTCCACACAAGAGGGG + Intronic
1031983139 7:128142804-128142826 TTCTCGGCTCCTCACAAGTATGG - Intergenic
1032221250 7:129995905-129995927 TTCTAGGTACCTCATATAAGTGG + Intergenic
1032496036 7:132363408-132363430 CTCTAGGAACCTCATATGAGTGG + Intronic
1032543469 7:132723513-132723535 TTCTAGGTGCCTCATATAAGTGG + Intronic
1033292893 7:140103190-140103212 TTCTAGGAACCTCATATAAGTGG + Intronic
1033994293 7:147326261-147326283 TTCTAGGTACCTTATATGAGTGG + Intronic
1034975125 7:155444144-155444166 TTCTAGGAGCCTCATGCGAGTGG - Intergenic
1036192578 8:6684198-6684220 CTCTAGGCTCCTTACATGAGTGG - Intergenic
1036218351 8:6899724-6899746 CTCTAGGTACCTCATATGAGTGG + Intergenic
1037539891 8:19860981-19861003 TTCTAGGTGCCTCATATGAGTGG - Intergenic
1038022152 8:23559716-23559738 CTCTAGGCACCTCATATCAGTGG + Intronic
1038135974 8:24786248-24786270 TTCTAAGTACCTCATATGAGGGG - Intergenic
1038333218 8:26626052-26626074 TTCTAGGGACCTCATACAAGTGG + Intronic
1042161088 8:65896437-65896459 TTCTAGTTTCCTCATATAAGTGG - Intergenic
1042266900 8:66917628-66917650 TTCTAGGTACCTCATATAAGTGG + Intronic
1042951873 8:74208726-74208748 TTCTAGGCACCCCATATAAGTGG + Intergenic
1043509551 8:80936111-80936133 TCCTAGGTACCTCATAACAGTGG + Intergenic
1044561481 8:93616952-93616974 CTCTAGGTACCTCATATGAGTGG - Intergenic
1045015607 8:97999061-97999083 TTCTAGGTGCCTCATATAAGTGG + Intronic
1045838112 8:106547365-106547387 TTCTAGGTACCTCATAGAAGTGG + Intronic
1050939283 9:11439395-11439417 TTCTAGGCTTCTGCTAGGAGGGG - Intergenic
1052869551 9:33490389-33490411 TTCTAGGTACCTCACATGAGTGG + Intergenic
1052926320 9:34019833-34019855 TTCTAGGAGCTTCGTAAGAGTGG - Intronic
1056021739 9:82445089-82445111 TTCTAGCCTCCTCCTAGGACTGG - Intergenic
1056502007 9:87218812-87218834 CTCTAGGTGCCTCATAAAAGTGG - Intergenic
1057647567 9:96891048-96891070 TTCTAGGTACCTCATATAAGTGG - Intergenic
1057801479 9:98193672-98193694 TTCTAAGCTTCTAATAATAGTGG + Intergenic
1058067945 9:100570003-100570025 TTTTAGGTTCCACATATGAGTGG + Intronic
1060460291 9:123846621-123846643 TTCTAGTTTCCTCATATAAGTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186611531 X:11142670-11142692 TACAAGGGTCCTTATAAGAGAGG + Intronic
1187050359 X:15689563-15689585 CTCTAGGCACCTCATATGAGTGG + Intronic
1187530989 X:20096559-20096581 TTCTAGGTACCTCATATAAGTGG - Intronic
1187560696 X:20400272-20400294 TTCTAGGTACCTCATATAAGTGG + Intergenic
1188374747 X:29414113-29414135 TTCTAGGTACCTCATATGAGAGG - Intronic
1188731199 X:33648167-33648189 TCCTAGGCTGCACATAACAGGGG + Intergenic
1188890405 X:35605212-35605234 TTCTAGGGGCCTGATGAGAGTGG + Intergenic
1188905724 X:35789036-35789058 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
1191024162 X:55895737-55895759 TTCTATGTTCCTCATATAAGTGG + Intergenic
1192016013 X:67331950-67331972 CTCTAGGCACCTCATATAAGGGG + Intergenic
1192585993 X:72318584-72318606 TTCGAGGCTCCTGAGCAGAGGGG - Intergenic
1193730909 X:85101941-85101963 TTCTAGGTACCTCATATGACTGG - Intronic
1193938225 X:87649250-87649272 TTCTAGTTACCTCATAAAAGTGG + Intronic
1194645607 X:96454794-96454816 TACTAGTGTCCTCATAAGAAGGG - Intergenic
1194702411 X:97130528-97130550 TTCTAGGTACCTCATATAAGTGG - Intronic
1194745884 X:97627889-97627911 TTCTAGCCTCCTCATAGGCTTGG - Intergenic
1194993315 X:100568469-100568491 TGCTAGTCCCCTCATACGAGGGG + Intergenic
1195053064 X:101115873-101115895 TTCTAGGTACCTCATATAAGTGG + Intronic
1196138657 X:112236904-112236926 CACAAGGGTCCTCATAAGAGAGG + Intergenic
1198309455 X:135415991-135416013 CTCTAGGCACCTCATATAAGTGG - Intergenic
1198415465 X:136415409-136415431 TTCTAGTCCCCTCATATGAAAGG - Intronic
1199794934 X:151184951-151184973 TTCTAGCCACCTCATATGAGTGG + Intergenic
1199965354 X:152815656-152815678 TTCTAGGTACCTCATATAAGTGG + Intergenic
1200082254 X:153583519-153583541 CTCTAGGCCCCTCATAGAAGTGG + Intergenic
1201356107 Y:13098722-13098744 CTCCAGCCTCCTCATAAAAGTGG - Intergenic
1202028326 Y:20548063-20548085 TTTAAGGGTCCTCAGAAGAGAGG + Intergenic