ID: 1137740749

View in Genome Browser
Species Human (GRCh38)
Location 16:50770603-50770625
Sequence CACAAAAATTAGCTGGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2973
Summary {0: 1, 1: 7, 2: 121, 3: 907, 4: 1937}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137740749_1137740756 14 Left 1137740749 16:50770603-50770625 CCCGAGCCCAGCTAATTTTTGTG 0: 1
1: 7
2: 121
3: 907
4: 1937
Right 1137740756 16:50770640-50770662 AGGGTTTCACCATGTTGGCCAGG 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
1137740749_1137740753 -6 Left 1137740749 16:50770603-50770625 CCCGAGCCCAGCTAATTTTTGTG 0: 1
1: 7
2: 121
3: 907
4: 1937
Right 1137740753 16:50770620-50770642 TTTGTGTTCTTAGTAGAGAGAGG 0: 2
1: 204
2: 14853
3: 270022
4: 189082
1137740749_1137740755 9 Left 1137740749 16:50770603-50770625 CCCGAGCCCAGCTAATTTTTGTG 0: 1
1: 7
2: 121
3: 907
4: 1937
Right 1137740755 16:50770635-50770657 GAGAGAGGGTTTCACCATGTTGG 0: 279
1: 35589
2: 128923
3: 148593
4: 97461
1137740749_1137740757 18 Left 1137740749 16:50770603-50770625 CCCGAGCCCAGCTAATTTTTGTG 0: 1
1: 7
2: 121
3: 907
4: 1937
Right 1137740757 16:50770644-50770666 TTTCACCATGTTGGCCAGGCTGG 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
1137740749_1137740754 -5 Left 1137740749 16:50770603-50770625 CCCGAGCCCAGCTAATTTTTGTG 0: 1
1: 7
2: 121
3: 907
4: 1937
Right 1137740754 16:50770621-50770643 TTGTGTTCTTAGTAGAGAGAGGG 0: 1
1: 45
2: 4169
3: 82713
4: 255996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137740749 Original CRISPR CACAAAAATTAGCTGGGCTC GGG (reversed) Intronic
Too many off-targets to display for this crispr