ID: 1137742175

View in Genome Browser
Species Human (GRCh38)
Location 16:50789459-50789481
Sequence GAGTGGGTAGGGAGGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 2, 1: 1, 2: 1, 3: 46, 4: 524}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137742166_1137742175 14 Left 1137742166 16:50789422-50789444 CCAGTAATAACATAGGTTGAATA 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG 0: 2
1: 1
2: 1
3: 46
4: 524
1137742165_1137742175 15 Left 1137742165 16:50789421-50789443 CCCAGTAATAACATAGGTTGAAT 0: 1
1: 0
2: 0
3: 16
4: 118
Right 1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG 0: 2
1: 1
2: 1
3: 46
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137742175 Original CRISPR GAGTGGGTAGGGAGGGATCA GGG Intronic
900292500 1:1929405-1929427 GTGAGGGTAGGGAGGGAGCGAGG + Intronic
900404916 1:2488489-2488511 GAGTGGGCAGGCAGGGCGCAGGG - Intronic
900536853 1:3182919-3182941 GAGTGGGGAGGCAGGGAGCTCGG - Intronic
901040498 1:6360340-6360362 GCCTGGGTGGGGAGGGCTCAGGG - Intronic
901758373 1:11455193-11455215 GCGTGGGAAGGGGGGGATCCAGG - Intergenic
901874335 1:12158372-12158394 GAGTGGGTTTGGAGGGGTTACGG + Intergenic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902650061 1:17831240-17831262 GAGGGAGTAGGGAAGGATGAAGG + Intergenic
903170386 1:21548751-21548773 CAGTGGGGAGGCAGGGAGCAGGG - Intronic
903200618 1:21735163-21735185 AAGTGGGTAGGGGAGGATCATGG - Intronic
903223354 1:21881110-21881132 GAGTGGTCAGGGAGGGCTCCCGG + Intronic
904350313 1:29900914-29900936 AAGTGGCTAAGGAGGCATCAGGG + Intergenic
905303112 1:36999025-36999047 GGGTGGGGAGGGAAGGAGCAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906128522 1:43442199-43442221 CAGAGGGGAGGGTGGGATCAAGG + Intronic
906186962 1:43869643-43869665 GAGTGGGAAGGGAGTGAGCTTGG - Intronic
906692294 1:47800510-47800532 GACAGGGTAGGGAGAGAGCATGG + Intronic
906974888 1:50559703-50559725 GAGTGGGTAGGATGTAATCATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907385339 1:54122139-54122161 TAGTGGGAAGGGAGAGTTCAAGG - Intergenic
907591341 1:55675195-55675217 AAGTGGGGAGGGTGGGAGCAGGG - Intergenic
907922297 1:58924893-58924915 GATTGGGTGGGGAGGAATCAGGG - Intergenic
908131193 1:61077124-61077146 GAGGGGGCAGGGAGGGGGCAGGG - Intronic
908318357 1:62956945-62956967 GAGAAGGGAGGGAGGGATGAAGG - Intergenic
908424849 1:63996833-63996855 GATTGGGTGAGGAGAGATCATGG + Intronic
908878230 1:68701713-68701735 GAGTTGGTGGGGAGGGTGCAGGG - Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912687066 1:111776034-111776056 GAGTGGGTAGTGGGGAATGAAGG - Exonic
913511067 1:119563022-119563044 GAGCAGGTAGGGAGAGATAATGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
914828919 1:151156601-151156623 GAGTAGGTAGGCGGGGCTCAAGG + Intergenic
915216726 1:154345344-154345366 CAGTGGGCAGGAAGGGATCCAGG + Exonic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
916212148 1:162367816-162367838 GAGGGGGTAGGGGGGCATCACGG - Exonic
916476550 1:165174804-165174826 GAATGGGAAGGTGGGGATCAGGG + Intergenic
917251006 1:173060636-173060658 GAGTGGGGAAGAAGGGGTCATGG - Intergenic
918097933 1:181349753-181349775 GGTTGTGTAGGGAGGAATCAGGG + Intergenic
919990075 1:202703414-202703436 AAGTGGGGAGGGAGAGATGAAGG + Intronic
920352581 1:205347286-205347308 AATAGGGTAGGGAGGGACCAAGG - Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921095299 1:211882069-211882091 GAGTGGGGAGAGAGGGATGGGGG - Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921847647 1:219901000-219901022 GAGAGGGGAGGGAGGGAGAAAGG + Intronic
922494680 1:226047312-226047334 GAGTGGGGAGGGAATGGTCAGGG - Intergenic
923861781 1:237898918-237898940 CAGGGGGAAGGAAGGGATCAGGG - Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924576332 1:245284034-245284056 GAGAGGGAAAGGAGGGATGAGGG - Intronic
1064890882 10:20171936-20171958 GACTGGGAAGGGTGGGAGCAGGG + Intronic
1064982029 10:21174383-21174405 GGCTGGGGAGGGAGGGATCCAGG + Intergenic
1065178828 10:23104840-23104862 GAGAGTGTGGGGAGGGATGACGG - Intronic
1065405168 10:25356164-25356186 GAGTGGGGAGAGGGGCATCATGG + Intronic
1065611285 10:27473007-27473029 GTGTTGGCAGGAAGGGATCAAGG + Intergenic
1067522298 10:47016974-47016996 GAGGGGGTGGGAAGGGAGCATGG + Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069881780 10:71597889-71597911 GTGGGGGTGGGGCGGGATCATGG - Intronic
1070341914 10:75505731-75505753 GAGTAGGGGTGGAGGGATCAGGG - Intronic
1070368664 10:75760689-75760711 GGGTGGATAGGGAAGGATGAGGG + Intronic
1070959480 10:80488541-80488563 GACAGGGGAGGGAGGGAGCAGGG + Intronic
1071244682 10:83750089-83750111 GACTGGGTAGGTGGTGATCAAGG - Intergenic
1072029989 10:91509775-91509797 GAGCGGGTAGGGTGGGAGGAGGG + Intronic
1072229074 10:93398245-93398267 GATTGGGGAGGGAGGCATCCAGG - Intronic
1072529693 10:96307295-96307317 GGGTTGGTAGGGAGAGATTATGG + Intronic
1075389724 10:122083712-122083734 GAGTGAGCAGGGAAGGTTCAGGG - Exonic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1077164176 11:1127661-1127683 GAGCGGGTAGCGTGGGCTCAGGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077921272 11:6643536-6643558 GAGTGGGCAGGGAAGCATGATGG - Intronic
1078666760 11:13332133-13332155 AGGTGGGGAGGGAGGAATCAGGG + Intronic
1079580349 11:22055873-22055895 CAGTGAGGAGGGATGGATCAGGG + Intergenic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1081737480 11:45414043-45414065 GGGTGGGTTGGGAGGGCTCATGG + Intergenic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1083630148 11:64091119-64091141 GAGAGGGTGGGGAGGGGGCATGG + Intronic
1083747107 11:64742769-64742791 GAGTGGCTCGGGAGGGCACACGG - Intronic
1083803603 11:65060510-65060532 GAGTGGGTGGGGTAGGACCATGG - Intergenic
1084145953 11:67265543-67265565 GAGTAGGAGGGGTGGGATCAGGG + Intergenic
1084313272 11:68328985-68329007 GTGTGGGAAGGGCGGGCTCACGG - Intronic
1084440198 11:69168289-69168311 GAGAGGGTAGAGAGGGAGAAGGG + Intergenic
1084590068 11:70085321-70085343 GGGTGGCTTGGGAGGGCTCAGGG - Intronic
1084697512 11:70764482-70764504 GAGAGGGGAGGGAGGGATAAAGG - Intronic
1084712253 11:70851105-70851127 CAGAGAGTAGGGAGGGATCCTGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085388789 11:76171813-76171835 TTGGGGGTAGGGAGGAATCATGG - Intergenic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086486647 11:87310477-87310499 GAGGAGGGAGGGAGGGAGCAGGG + Intronic
1086889048 11:92235267-92235289 GAGAGGGTTGGGAGAGATAAAGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087628829 11:100626695-100626717 GAGTGTGAAAGGAGGGAACAAGG + Intergenic
1088158797 11:106842717-106842739 AAGGGGGTAGGGAGGAATGAAGG + Intronic
1088354116 11:108923732-108923754 GAGTAGGTAGGGAATGAACATGG + Intronic
1089067906 11:115676019-115676041 GATTGGAGAGGGAGGGATAAGGG - Intergenic
1089132194 11:116221529-116221551 GAGTGGGTGGGGGGGGAACCAGG - Intergenic
1089257974 11:117204031-117204053 GGGTGGAAAGGGAGGGGTCAAGG - Intronic
1089756230 11:120689439-120689461 GGGTGGGTATGGCTGGATCATGG - Intronic
1090303728 11:125672097-125672119 GAGTGTGTAGGGATGGAAAAGGG + Exonic
1090405399 11:126473241-126473263 GAGTGGGTGGGGAGGGGGCTAGG - Intronic
1091096360 11:132825959-132825981 GAGTGGTTAGGGAGGTAGCGGGG - Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091389616 12:118009-118031 AAGTGGGGAGGGAGGGAGCTGGG + Intronic
1093173249 12:15882524-15882546 GAGGGGTGAGGGAGGGGTCAGGG - Exonic
1093689051 12:22088933-22088955 GAGTTTGTGGGGAGAGATCAGGG + Intronic
1094304202 12:28999295-28999317 GAGTGGGCAGGAAGGGTCCAAGG - Intergenic
1095211272 12:39497975-39497997 GAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1095582096 12:43812364-43812386 GATTGGGTGGGCTGGGATCAAGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095942906 12:47738096-47738118 GCGGGGGTGGGGAGGGGTCATGG + Intronic
1096000137 12:48122510-48122532 AATTGGGGTGGGAGGGATCAGGG + Intronic
1096074684 12:48795678-48795700 GGGTGGGTAGGGTGGGGTAATGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096535789 12:52273273-52273295 GACAGGGTAGGGAAGGAGCATGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1097179475 12:57163042-57163064 GAGTGGGGAGGGGAGGATCCAGG + Intronic
1097636374 12:62127309-62127331 GAGTGGGTAGGGAATGATGGAGG - Intronic
1098838878 12:75455045-75455067 TAGTGGCTTGGGAGGGAGCATGG - Intergenic
1100649203 12:96566298-96566320 GAGTGGGGAGGAATGGATGAGGG + Intronic
1100672112 12:96824710-96824732 GTTTGGGTAGGAAGTGATCACGG - Intronic
1101091867 12:101295180-101295202 CTGGGGGTAGGGAGGGTTCATGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101718276 12:107330171-107330193 GAGAGGGTAGGGAGGGAGCCTGG + Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102531354 12:113548570-113548592 GAGTGGGAAGGGAGGGAGCCAGG + Intergenic
1102782257 12:115575492-115575514 GAATGGGTAGGCAGGGATGCTGG - Intergenic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1102997487 12:117361349-117361371 GAGGGGGTGGGGAGGGATCTTGG - Intronic
1103214310 12:119189800-119189822 GGTTGGCTAGGGAGGGCTCAGGG - Intronic
1104673933 12:130700082-130700104 GGGTGGCTGGGGAGGGAACATGG - Intronic
1104849218 12:131863293-131863315 AAGTGGGGAGGGAGGGGTGAAGG + Intergenic
1105402636 13:20109475-20109497 GAGAGGGCAGGGAAGGAGCATGG - Intergenic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1107582358 13:41804090-41804112 GAGGAGGTAGAGAGAGATCAGGG + Intronic
1108267310 13:48725078-48725100 GAGTAGGTTGGGTGGGGTCATGG + Intergenic
1108495346 13:51019267-51019289 GAGTGGGTAGGGTGGGGTTCAGG - Intergenic
1108907254 13:55492774-55492796 AGGAGGATAGGGAGGGATCAGGG - Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1110567140 13:76968023-76968045 CAGTGAGGAGGGATGGATCAGGG + Intergenic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112695915 13:101947685-101947707 GAGGGGGTAGGGAGGGATCATGG + Intronic
1113329993 13:109318047-109318069 GGGTGGATAGGGAAGGCTCATGG - Intergenic
1113417908 13:110144935-110144957 TAGTGGGTATGAAGGGGTCACGG - Intergenic
1113909813 13:113836560-113836582 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909825 13:113836582-113836604 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1114533920 14:23411521-23411543 AAGGGGGTAGGGAGGGGACAAGG - Intergenic
1114737873 14:25061630-25061652 GAGTGGGAAGGGTGGGATAGGGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115017391 14:28633745-28633767 GAGTGGCTAGGCAGGGGTCCTGG + Intergenic
1115273774 14:31583849-31583871 GAGTGGAGAGGAAGGGCTCAAGG + Intronic
1115787316 14:36840919-36840941 GAGTGGGTAGGCAGTGTTCTTGG - Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116182580 14:41553880-41553902 GAGTGTGGAGGGTGGGATGAGGG + Intergenic
1116829690 14:49706103-49706125 GGGTGGGTAGGGATGGCTAATGG - Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117627019 14:57650748-57650770 GGGTGGGCAGGGATGGACCACGG - Intronic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118353292 14:64989925-64989947 GAATGGGTGGGGTGGGAGCAGGG + Intronic
1118744427 14:68763382-68763404 GAGGAGGTAGGGAGGGATGGTGG + Intergenic
1118835365 14:69474072-69474094 GAGTGGGTGGGGAGGGTGCCTGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1120280231 14:82429853-82429875 AAGTGGGGAGGGAGGGGACAGGG - Intergenic
1120492072 14:85190784-85190806 GAGTTGGGATGGAAGGATCAAGG + Intergenic
1120952149 14:90051265-90051287 GAATGGGTAGGAAGGAAACAGGG + Intergenic
1121503451 14:94458606-94458628 GAATGGGTAGGGAAGGACCATGG + Intergenic
1121654904 14:95588193-95588215 GAGTGGGGAGGGACGGAGCCAGG + Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122443898 14:101755381-101755403 GGGTGGGTAGGGAGGGCTACTGG - Intergenic
1124616281 15:31244707-31244729 GACTGTGGAGGAAGGGATCAGGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125361280 15:38867230-38867252 GAGTGGGGAGGGAGGCATTGAGG - Intergenic
1125507559 15:40275786-40275808 GAGGGGGTGGGGAGGGACAAGGG + Intronic
1125734387 15:41913460-41913482 CAGTGGGTAGGCAGTGGTCACGG - Intronic
1126333813 15:47564781-47564803 GATGGGGTAGGGCGGGGTCATGG - Intronic
1126849276 15:52787641-52787663 GAGTGGGGGGGGAGGGGGCATGG + Intronic
1127041213 15:54978938-54978960 GAATGTGTAGGGTGGGAACAGGG - Intergenic
1127579855 15:60328222-60328244 GAGGGGGGAGGGAGGGATAGGGG + Intergenic
1128570824 15:68731551-68731573 GAGGGGATAGGGAGGCAACAGGG + Intergenic
1128880494 15:71237777-71237799 GAGTGTGTAGGGAGGGAGACTGG + Intronic
1128941315 15:71790173-71790195 GAGTGTGTCGGGAGGGTGCAGGG - Intergenic
1129944075 15:79524204-79524226 GAGTGGGAAGGGAGGAGTGATGG - Intergenic
1131263676 15:90903149-90903171 GAGCGGGTGGGGAGGGAGCCGGG + Exonic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133146637 16:3791891-3791913 GAGTAGGTAGGGAGTGGGCAGGG - Intronic
1133876638 16:9740999-9741021 GAGTGGGTGGGGTGTGCTCAAGG - Intergenic
1135053818 16:19214036-19214058 TAGTGGGTAGAGAGAGACCAGGG - Intronic
1135531074 16:23255153-23255175 GAGTGGGAAGGGAGGGAGTGGGG + Intergenic
1136500061 16:30665541-30665563 CACTGGGCAGGGAGGGATCATGG - Intronic
1137093318 16:36221659-36221681 GAGTGGGGAGGAAGGGAGAAAGG + Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1137819123 16:51426699-51426721 GAGTGTGTAGTAAGGGATCTTGG + Intergenic
1139382736 16:66543862-66543884 GAGTGGGCTGGGAGGGACCCAGG - Intronic
1139468639 16:67166909-67166931 GAGAGGGGAGGGAGGGAACCTGG - Intronic
1139550922 16:67672586-67672608 GTGTGGATAGGGAGGGATCTTGG + Intergenic
1139676299 16:68526277-68526299 GAGTGGGGAGGAAGAGATGAGGG - Intergenic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141490303 16:84368234-84368256 GACTGGGCAGGGAGGGGTCTGGG + Intergenic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1142667219 17:1470077-1470099 GATTGGTCAGGGAGGGCTCACGG - Intronic
1143060697 17:4198200-4198222 AATTGTGTAGGGAGGGATCCTGG - Intronic
1144212309 17:13025855-13025877 GAGAGGGAAGAGAGGGAGCAAGG - Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1146054379 17:29573880-29573902 GCGAGAGTGGGGAGGGATCAGGG + Exonic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1147237913 17:39071372-39071394 GGGTGGGTTGGGAGGGAACTAGG + Intronic
1147382109 17:40062300-40062322 GAGAGGGGAGGGAGGTAACAGGG + Intronic
1147387701 17:40091721-40091743 GAGGGGGAAGGGAGGGGTCCGGG - Intronic
1148340980 17:46873281-46873303 GAGTGGGGAGGGAGGTAGAATGG - Intronic
1148638248 17:49165574-49165596 GAGTGGGGAGGGAGAGAGAAAGG - Intronic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149135663 17:53360313-53360335 AAGTGTGGAGGGAGGGACCAAGG + Intergenic
1149454517 17:56777132-56777154 GAGTAGGGTGGGAGGGGTCAGGG - Intergenic
1150294945 17:64002499-64002521 GGGTGGGGAGGGAGGCATCTAGG + Exonic
1150620537 17:66804483-66804505 GAGTGAGCAGGGAGGGATTGGGG + Exonic
1151579696 17:74971232-74971254 GAGTGGGGAGGCAGGGAGGAAGG - Intronic
1152103590 17:78316473-78316495 GAATGGGGAGGCAGGGAACAAGG - Intergenic
1152183816 17:78841368-78841390 GTTTGGGGAGGGAGGGATCTGGG + Intronic
1152876527 17:82789628-82789650 GCGTGGGCAGTGAGGCATCACGG - Intronic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1154942130 18:21124574-21124596 GAGAGGGTAAGGTGGGGTCAAGG + Intergenic
1155021037 18:21897166-21897188 GAGAGGGTTGGGAGGGGTCACGG - Intergenic
1155903966 18:31426948-31426970 GAGTGTGGAGGGAGGAATCGGGG - Intergenic
1156354361 18:36328747-36328769 AAGTGGGAAGAGAGGGGTCAAGG + Intronic
1156568886 18:38228535-38228557 GAGGGGGGAGGGAGGGAGCGAGG + Intergenic
1157442219 18:47719752-47719774 GAGGTGGTAGGGAGGGCCCAGGG - Intergenic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1160200170 18:76789162-76789184 GCGTGGCTGGGGAGGGAACACGG - Intergenic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1160722910 19:605025-605047 CAGCGGGTAGGGTGGGCTCACGG + Intronic
1160875657 19:1295260-1295282 GAGCGGGGAGGGACGGGTCAGGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161649868 19:5477912-5477934 GAGAGGGCAGGGAGGGGACAGGG - Intergenic
1161859198 19:6785004-6785026 CAATGGGTAGAGAGGGAGCAGGG - Intronic
1162101284 19:8340746-8340768 GAGTGGGAAGGGAGAGGTCAGGG - Intronic
1162257003 19:9498720-9498742 GCGTGGGTGCGGAGGTATCAAGG + Intergenic
1162404452 19:10465176-10465198 TAGTGGGTAGAGAGAGACCAGGG - Intronic
1162420861 19:10565492-10565514 GAGTGGGCAGGTGGGGATCGTGG + Intronic
1162491656 19:10995950-10995972 GAGTGGGTAGGACTGGCTCATGG + Intronic
1162842006 19:13363591-13363613 GAGTGGGGAGGGAGGGCTCAGGG + Intronic
1163124130 19:15235359-15235381 GAGTCGGTTGGGAGAGATCCTGG - Intergenic
1164178845 19:22802164-22802186 CAGTGAGAAGGGATGGATCAGGG + Intergenic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165460259 19:35940075-35940097 GAGTGGGTCGGGTGGGATTGTGG - Exonic
1165799226 19:38537431-38537453 GATTGGGCTGGGAGGGATAAGGG - Intronic
1165802523 19:38561788-38561810 GTGTGGGTAGGGCTGCATCAGGG - Intronic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1165938953 19:39405710-39405732 GAGTGGGTTGGGTGGGGTCCAGG - Intergenic
1165941491 19:39416773-39416795 GAGGGGTTAGGGAGGGGCCAGGG - Intronic
1166112839 19:40633496-40633518 GGGTGGTTAGGGAGGGCTCCTGG + Intergenic
1166379673 19:42349416-42349438 GGGTGGGTTTGGAGGTATCAGGG + Intronic
1166588185 19:43969671-43969693 CAGTGGGGAGGAATGGATCAGGG - Intronic
1166593920 19:44027620-44027642 GGGTGGGAAGGGTGGGAGCAGGG - Intronic
1166597284 19:44060977-44060999 GAGTGGGAAGGCACGGAGCAGGG - Intronic
1166667429 19:44689488-44689510 GAGTGGGGAGGGAGGTGTCCAGG - Intergenic
1167193988 19:48014054-48014076 GCGGGGGCAGGGAGGGAACACGG + Intronic
1167200532 19:48062067-48062089 GAGTGGGAAGGGAGTGTTGATGG + Exonic
1167428776 19:49442797-49442819 GGGAGGGTAGGGAGAGATCCAGG - Intergenic
1168098996 19:54131108-54131130 GAGAGGGTGGGGAGGAACCAGGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168345165 19:55647109-55647131 AAGTGGGGAGGGGAGGATCATGG + Intronic
925426991 2:3757949-3757971 GAGTGGGCACGTAGGGGTCAGGG + Intronic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927264668 2:21131953-21131975 GAGAGGGTAGGGAGGGGCTAGGG + Intronic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
929452400 2:42046734-42046756 GATTGGCTGGGGAGGGGTCAGGG - Intergenic
930136264 2:47906186-47906208 GAGAAGGGAGGGAGGGAGCAGGG + Intergenic
930628449 2:53725284-53725306 GAGAGGGGAGGCAGGGAACAGGG + Intronic
930752228 2:54945139-54945161 GGAGGGGTAGGGAGGGATGAGGG - Intronic
931382873 2:61769691-61769713 TAGTGGGTAGGGAAGGATTTGGG + Intergenic
931784752 2:65608822-65608844 GAGTGGGTAGGAAGGCAGGAGGG + Intergenic
931924030 2:67051689-67051711 GGGAGGGAAGGGAGGGATGAAGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932531101 2:72533542-72533564 GACTGGGTAGTGAGAGATGATGG - Intronic
932578281 2:72974768-72974790 GAGTGGGATGGGAAGGATCAGGG - Intronic
932624304 2:73285118-73285140 GAGTGGGTAGGAGGGAACCAGGG - Intergenic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
934479112 2:94618684-94618706 CAGTGAGTAGGGATGGATCCAGG + Intergenic
934712746 2:96526625-96526647 GAGTGGGTGGGGTGGGCCCAGGG - Intergenic
935209239 2:100924152-100924174 GTGTGTCTAGGGAGGGCTCAGGG - Intronic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
936728574 2:115354321-115354343 GAGGGGGTAGGGAGGGAATGTGG - Intronic
936948702 2:117954967-117954989 GCATGGGTAGGGAGGCCTCAGGG - Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
939416413 2:141904370-141904392 AAGAGGGTAGGGAAGAATCAAGG + Intronic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
940281035 2:151989883-151989905 GAGGGGGAAGGGAAGCATCAAGG - Intronic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
943808875 2:192159264-192159286 GAGTGTTGAGGGGGGGATCAAGG + Intronic
944778981 2:202998224-202998246 GAGTGGGGAGGGTGGGATAGGGG - Intronic
946038853 2:216766439-216766461 GAGTGGGAAGGGGGGTGTCATGG - Intergenic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946954844 2:224918032-224918054 AGATGGGTAGGGAGGGGTCAAGG + Intronic
947698933 2:232216525-232216547 GAATGGCTAGGGAGGCTTCACGG - Intronic
948106069 2:235414685-235414707 GAGTGGGTATGAAGGGAACTGGG + Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169939801 20:10924757-10924779 GGGTGGGAAGGGAGACATCAGGG - Intergenic
1170332321 20:15227347-15227369 GAGAAGGGAGGGAGGGATAAGGG - Intronic
1171346839 20:24471461-24471483 GAGAGGGGAGGGAGGAATTAAGG - Intronic
1172160244 20:32863034-32863056 CAGAGGGGAGGGAGGAATCATGG - Intronic
1172179009 20:32989402-32989424 GGGTGGGGTGGGAGGGAACACGG - Intronic
1172758528 20:37305509-37305531 CAGTGGGTAGGGGGGTATGATGG - Intronic
1172887230 20:38239485-38239507 GAGGTGGTAGGGAGGGAGCTGGG - Intronic
1173058118 20:39635900-39635922 GAGTGGGTGGGGGGGGTCCATGG + Intergenic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1174465361 20:50712978-50713000 GAGGGGGAAGGGAGGGGGCAGGG + Intergenic
1174834373 20:53842131-53842153 GAGTGGGTACCGGGGGATTAGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175823577 20:61924666-61924688 GAGTGGGTGGAGGGGGAGCATGG - Intronic
1175890502 20:62313827-62313849 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890509 20:62313855-62313877 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890516 20:62313883-62313905 GAGTGGGCACGGAGAGATGAGGG + Intronic
1176041210 20:63066800-63066822 GAGAGGTCAGGGAGGGGTCAGGG - Intergenic
1176070147 20:63222087-63222109 GTGTGGGCACAGAGGGATCAGGG - Intergenic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1178518554 21:33268112-33268134 GAGGGGGTAGGGTGGGCACATGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179484656 21:41702154-41702176 GAATGGGTAAGGAGGCCTCAGGG + Intergenic
1179986282 21:44922200-44922222 GACTGGGTTGGGAGGGGCCAGGG + Intronic
1180002709 21:45002337-45002359 GAGGGGTTAGGGAGGGAGCTGGG + Intergenic
1180671556 22:17557665-17557687 GGGTGGGTGGGGTGGGAGCAGGG + Intronic
1180673887 22:17573813-17573835 AAGTGGAGAGGGAGGGATTAGGG - Intronic
1180690090 22:17706725-17706747 GAATGAGGAGGGAGGGAGCAAGG - Intronic
1180731244 22:17984199-17984221 GGGTTGGCAGGGAGGGACCAGGG - Intronic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181604384 22:23971530-23971552 GATTGGGCACGGAGGGATCCAGG - Exonic
1181731432 22:24849753-24849775 GAATGGGTGGGGAGGGAACCCGG + Intronic
1182778601 22:32849699-32849721 GGATGGGTAGGGAGGGGGCATGG + Intronic
1182876365 22:33694719-33694741 GAGGGGGAAGGGAGGGAGTAGGG + Intronic
1183381494 22:37492560-37492582 GAGTGGAGAGGGAGAGATGAAGG + Intronic
1183776369 22:39968814-39968836 GAGTTGGCAGGGAGGCAGCAGGG - Intronic
1184051387 22:42008166-42008188 GAGAGGGAAGGGAGGGAGAAAGG - Intronic
1184511590 22:44936483-44936505 GAGTGGGCAGCGAGGCATCCAGG - Intronic
1184783517 22:46660767-46660789 GAGTGGGGAGGGAGGAAGCTGGG - Intronic
950726779 3:14922020-14922042 GAGTGGGTGGGCAGGGCCCACGG + Intronic
951088251 3:18540020-18540042 GGGTGGGGAAGGAGGGATCTAGG + Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
952030452 3:29135851-29135873 GAGGGAGGAGGGAGGGAACAAGG + Intergenic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
952755039 3:36858507-36858529 GAGTGGTCAGGGAGGGTTGATGG - Intronic
952979083 3:38720730-38720752 GAGAGAGAAGGGAGGGAGCAAGG + Intronic
953098866 3:39806704-39806726 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954075606 3:48177152-48177174 GTGTGGGTTAGGAGGGACCATGG - Intronic
954160159 3:48715592-48715614 GCCTGGGTAGGGAGGGAGCAAGG - Intronic
954379654 3:50212839-50212861 GAGTGGGGATGGGGGGTTCAGGG + Intronic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958770688 3:98422019-98422041 GGGTGGGAAGGGAAGGACCATGG - Intergenic
959993661 3:112656841-112656863 GAGTGGAGAGGGAGGGAGAAAGG - Intergenic
960927589 3:122810901-122810923 AAGTGGTAAGGGAGGGATCTAGG - Intronic
961927535 3:130497095-130497117 TAGGGGGTAGAGAGGGATTAGGG - Intergenic
962037431 3:131667581-131667603 GAGGGGGGAGAGAAGGATCAGGG - Intronic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964285883 3:155117801-155117823 CAGGGGGTGGGGAAGGATCAGGG + Intronic
964705868 3:159617883-159617905 GAATGGGTATGTAGGGATGAAGG - Intronic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966181745 3:177195370-177195392 GTGTGGGTTGGGTGGTATCATGG - Intronic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966715740 3:183011400-183011422 GGGAGGGTAGGGAGGGGACAGGG + Intergenic
966886297 3:184379807-184379829 GAGGGGGAGGGGAGGGACCAGGG - Intronic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967720189 3:192807959-192807981 GAGTGGGGCGGGAGGGATTGGGG + Intronic
968541444 4:1170442-1170464 GACTGGGGCGGGAGGGATGAAGG + Exonic
968592459 4:1465876-1465898 GACAGGGCAGGGAGGGGTCAGGG - Intergenic
969058505 4:4416668-4416690 GAGGGGGTAGGGAGGGGCCGTGG - Intronic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
970654259 4:18213619-18213641 GAGTGGGCAGGCAGGGACCTTGG + Intergenic
971240831 4:24887515-24887537 GAGTGAGTAGGTGGTGATCAGGG - Intronic
971557612 4:28034705-28034727 GAGTAGGTAGGGATGGTTAATGG + Intergenic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973221355 4:47730873-47730895 GTGTGCATAGGGAGGTATCAAGG + Intronic
973284816 4:48403432-48403454 CAGTGAGGAGGGATGGATCAGGG + Intronic
974931189 4:68363404-68363426 GTGTGGGTAGTGGTGGATCAAGG - Intergenic
976108199 4:81641894-81641916 GAGTGGGTAGAGATGGGACAAGG - Intronic
976307332 4:83573647-83573669 GAGATGGTAGGGAAGGATCTAGG + Intronic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
977285211 4:95097251-95097273 GAGAGGGGAGGGAGGGACAAAGG + Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978940413 4:114429382-114429404 CAGTGAGAAGGGATGGATCAGGG + Intergenic
979474463 4:121138850-121138872 GAGGGGGTAGGGAGAGATGATGG - Intronic
980647686 4:135664075-135664097 GACTAGGTAGGGAGTAATCATGG + Intergenic
983568014 4:169175094-169175116 GAATGGGAACGGAGGCATCATGG - Intronic
983908383 4:173208513-173208535 GAGGGGGTAAGAAGGGATAAAGG - Intronic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984600564 4:181721632-181721654 GAGTGGGTAGGGTAAGATCTGGG + Intergenic
984632226 4:182073292-182073314 CAGTGGGAAGTGATGGATCACGG - Intergenic
984787372 4:183580795-183580817 TAGGGGGTTGGGAGGGAGCAGGG - Intergenic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
985011584 4:185588017-185588039 GAGTCGGGGGTGAGGGATCAAGG + Intronic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985561064 5:586094-586116 GAGAGGGTAGGAAGGGAAGAAGG + Intergenic
985708244 5:1413980-1414002 GAGAGGGTGGGGAGGGGTCCAGG - Intronic
986495076 5:8333213-8333235 GAGTGGGTAGGGAGGGAGTGAGG + Intergenic
986971865 5:13346220-13346242 GAGTGGGTGGGCAGGAAGCAGGG + Intergenic
987298364 5:16574411-16574433 GACGGGGTAGGGAGGAAGCATGG + Intronic
987304735 5:16626671-16626693 CAGTGGGTAGTGATGGATCTAGG - Intergenic
987314724 5:16713551-16713573 GGGAGGGGAGGGAGGGAGCAAGG + Intronic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
989596115 5:43157749-43157771 TAGTGTCTTGGGAGGGATCATGG - Intronic
991408092 5:66321054-66321076 GAGTGGGGAGGGGAGGATGAGGG + Intergenic
992301110 5:75381344-75381366 AAGTGGGTGGGGAGGAATCCTGG - Intronic
993147511 5:84114079-84114101 AATTGGTGAGGGAGGGATCAAGG + Intronic
994502895 5:100602444-100602466 GGGTGGGGAGGGAGGGAGCATGG + Intergenic
994618865 5:102138796-102138818 GAGTGGGGAGGGTGGGAGAAGGG - Intergenic
994940639 5:106319240-106319262 GAGGGTGGAGGGTGGGATCAGGG + Intergenic
995873359 5:116765238-116765260 GGGTGGGGAGGGGGGGAACAGGG - Intergenic
996482218 5:123988330-123988352 TAGTGAGGAGGGATGGATCAGGG + Intergenic
996821739 5:127636968-127636990 GAGTGGGTAGCAAGGGACCGAGG + Intergenic
998164431 5:139834955-139834977 GAGTGGGAAGGGAGGGTTTGGGG - Intronic
998390777 5:141785815-141785837 GAATGAGTGGGGAGGGATGATGG - Intergenic
998878003 5:146619752-146619774 GAGAGGTTAGGGAAGGAGCATGG - Intronic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
1001525023 5:172422778-172422800 GAGCGGGTAGTGAGGAATCCTGG - Intronic
1001582162 5:172806281-172806303 GAAGGGGTAGGCAGGGATCGAGG - Intergenic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002595275 5:180318041-180318063 GAGGGGCTGGGGAGGGACCATGG + Intronic
1004607279 6:17206432-17206454 GAGGGGGGAGGGAGGGTGCAGGG + Intergenic
1005203587 6:23375348-23375370 GAGGAGGGAGGGAGGGAGCAGGG - Intergenic
1005363010 6:25050008-25050030 GAGCAGGGAGGGAGGGATGAGGG + Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005935138 6:30515523-30515545 CAGTGGGTTGGTAGGGATCGGGG - Intergenic
1006473712 6:34242257-34242279 GAGAGGGTGGGCAGTGATCATGG + Intronic
1006602500 6:35235362-35235384 GAGAGGGTGGGGAGGGGTCCGGG + Intronic
1007397306 6:41585252-41585274 GGGTGCGGAGGGAGGGAGCAAGG - Intronic
1008419711 6:51284017-51284039 GAGGGAGAAGGGAGGGATGAAGG + Intergenic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1009995164 6:70888807-70888829 GCCAGGGTAGGGAGGGATCATGG - Intronic
1014149824 6:118041802-118041824 GAGTGGGTAGAGTGGAGTCAGGG + Intronic
1015567453 6:134588074-134588096 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
1016533725 6:145088153-145088175 GAGTGCATAGGGAGGGCTCCTGG - Intergenic
1016764679 6:147778696-147778718 GAATGGAGAGGGAGGGAGCAGGG - Intergenic
1016846695 6:148575047-148575069 GAGTCAGAAGGGAGGGAGCATGG - Intergenic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018339053 6:162830328-162830350 GAGTGGGTAGGGGCAGGTCAGGG - Intronic
1018904494 6:168067225-168067247 GCGTGGGTTGGGAGAGAGCAGGG - Intronic
1019334129 7:474991-475013 GAGGGGGTGGGGGTGGATCAAGG + Intergenic
1019908501 7:4083250-4083272 GGGTTGGTAGGGAGGGATAGTGG - Intronic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1020040126 7:4995618-4995640 GAGTGGGTGGCGTGGGGTCAGGG + Intronic
1020527840 7:9286427-9286449 GAGTGGGTAGGGATTGATATTGG + Intergenic
1020837653 7:13174112-13174134 GAGAGGGTAGGGAAAGACCAGGG - Intergenic
1021027509 7:15686987-15687009 AAGTGAGTAGGTAGGAATCAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021301972 7:18984350-18984372 GGCTGGGTAGAAAGGGATCATGG + Intronic
1021383686 7:20001587-20001609 AAATGGGGAGGGAGGGATGAGGG + Intergenic
1021571363 7:22068457-22068479 GAGTGGATAGGGAGGATTTATGG + Intergenic
1021610483 7:22452951-22452973 GAGTAGGAAGGCAGGGAACAGGG + Intronic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1027270002 7:76513860-76513882 GCGTGGGTGGGGAGGGAGCGAGG + Intronic
1027417633 7:77990156-77990178 GCGTGGGTAGGGAAGGACCAGGG + Intergenic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027949386 7:84794900-84794922 GAGTGAGGAGGGAGGGAGAAGGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029137825 7:98387148-98387170 CAGAGGGTAGGGAAGGAGCAAGG + Intronic
1029389741 7:100267032-100267054 GGGTGGGTACAGATGGATCAGGG - Intronic
1029620600 7:101688055-101688077 GGCTGGGTAGGGTGGGCTCAGGG - Intergenic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1031074337 7:117198618-117198640 GAGTGGGTTGGCATGGAGCAAGG - Intronic
1034297831 7:149990058-149990080 GTGTGGGGAGGGATGGATGAAGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1035167174 7:156998712-156998734 GGGTAGGTAGGGAGGGTTAATGG + Intronic
1035752692 8:2007622-2007644 GAGTGGGTCGGGAGGTACCAGGG + Intergenic
1036693409 8:10959193-10959215 GAGTGGGGAGGGAGGGACACTGG - Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037502439 8:19498684-19498706 GAGTGGGCAGGAAAGGCTCAGGG - Intronic
1037643261 8:20768007-20768029 GAGTGGGAAGGAAGTGATAAAGG + Intergenic
1037822211 8:22140495-22140517 GAGTGGGGAGGGAGAGAGAATGG - Intronic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1038497353 8:28013111-28013133 GAGAGGGAAGAGAGGGAGCATGG + Intergenic
1039790390 8:40871364-40871386 GAGTGGGTAGGGATGGAGTAGGG - Intronic
1040452092 8:47558150-47558172 AAGAGGGGAGGGAGGGAGCAGGG + Intronic
1040478893 8:47805865-47805887 GAGTGGGGTGGGAGTGAGCAGGG - Intronic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040763102 8:50874420-50874442 CAGTGAGGAGGGATGGATCAAGG - Intergenic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041698612 8:60763453-60763475 GTGTGGGTGGGGAGCGGTCAGGG + Intronic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041735946 8:61110332-61110354 GAGAGGGAAGGGAGAGAGCAAGG - Intronic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042397007 8:68304577-68304599 CAGAGGGTAGGCAGGGTTCAGGG + Exonic
1042906054 8:73773410-73773432 GAGTGGGGATGGAGGCAGCAGGG - Intronic
1043226033 8:77731571-77731593 GAGTGAGTATGTAGGGATAAAGG - Intergenic
1043460318 8:80453380-80453402 GAGTGGGGAGGTGGAGATCAAGG + Intergenic
1045140826 8:99280318-99280340 GAGTGGCTTGGGAGGGAGTAGGG - Intronic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1047309385 8:123679030-123679052 GAGTGGGCAGGGTGTGTTCAGGG - Intergenic
1047364726 8:124201464-124201486 GAGGGGGTGGGGAGGGACGATGG - Intergenic
1047575980 8:126155662-126155684 GAGAGGGGAGGGAGGGAGCGGGG + Intergenic
1047723725 8:127666656-127666678 GAGTGGGTAGGGGGAGCTCCTGG - Intergenic
1048208869 8:132438379-132438401 GAATGGGCAGGGTGGGATCGGGG - Intronic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1048587703 8:135790574-135790596 CAGTGAGTAGGGATGGGTCAGGG + Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1049064108 8:140299295-140299317 GTGTGGGCAGGGGGGGGTCAGGG + Intronic
1049370369 8:142261383-142261405 GAGGGGGGAGGGAGGGATAGTGG + Intronic
1049645987 8:143735822-143735844 GGGTGGGTAGGGAAGGACCAGGG - Intergenic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1052040782 9:23736477-23736499 GAGTGGGGAGGGGAGGAGCAGGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053039391 9:34856989-34857011 CAGTGAGAAGGGATGGATCAGGG + Intergenic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1056989778 9:91399966-91399988 GAGTGGGTAGGTGAGGAGCAAGG - Intergenic
1058667125 9:107329777-107329799 GGGTGGGGAGGGAGGGATCTAGG + Exonic
1059086708 9:111310881-111310903 GAGGAGGGAGGGAGGGATGAAGG - Intergenic
1059598559 9:115749999-115750021 GAGTGGGTAGGAAAGAATAAGGG + Intergenic
1059669336 9:116478109-116478131 GAGGGGGTAGGGAGGGAGAAAGG + Intronic
1059740625 9:117146128-117146150 AATGGGGTCGGGAGGGATCAGGG - Intronic
1059957629 9:119534689-119534711 GAGTGGGTTGCTAGAGATCATGG + Intergenic
1059991087 9:119867425-119867447 GAGGAGGTAGAGAGGGAGCAAGG + Intergenic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060720177 9:125971313-125971335 GAGCTGGGAGGGAGGGAGCAGGG + Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186548696 X:10479456-10479478 GGGTGGGTAGGGATGGTTAATGG - Intronic
1186600777 X:11034540-11034562 GGGGAGGAAGGGAGGGATCAAGG + Intergenic
1186603698 X:11066233-11066255 GAGAGGGGAGGGAGGGAATAGGG - Intergenic
1187126367 X:16457757-16457779 GAGGGGGGAGGGAGGGATGGAGG + Intergenic
1187283714 X:17882970-17882992 GAGAGGGGAGGGAGGGAGAAAGG + Intergenic
1187483953 X:19684380-19684402 GACTGGGTGGGGAGGCAACAAGG - Intronic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187977707 X:24719870-24719892 CAGTGGGCAAGAAGGGATCAGGG - Intronic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1189849971 X:45168414-45168436 GAGTTGGTGGGGTGGGGTCAGGG + Intronic
1189907359 X:45775138-45775160 GAGTGGGCAGGGTGGGAGAAAGG + Intergenic
1190044533 X:47101443-47101465 GAGTGGGTAGGGAGGCTTCTTGG - Intergenic
1190870083 X:54417502-54417524 GAATGGGGAGGGAGGGGGCAAGG + Intergenic
1191701549 X:64047831-64047853 CAGTGAGGAGGGATGGATCAGGG - Intergenic
1191906246 X:66093845-66093867 CAGATGGGAGGGAGGGATCATGG - Intergenic
1191930341 X:66365220-66365242 CAGTGAGTAGGAATGGATCAGGG + Intergenic
1192238372 X:69310695-69310717 AAGTGGGTAGAGAGGTACCAGGG + Intergenic
1192264984 X:69531762-69531784 GAGTGTGTAGGCAGGGCACAGGG - Exonic
1193369153 X:80672420-80672442 GAGGGGGGAGGGAGGAATGAAGG + Exonic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193713275 X:84904135-84904157 TGGTGGGCAGGGAGGGATTAGGG - Intergenic
1194234434 X:91364704-91364726 GAGGGTGGAGGGAGGGAGCAGGG + Intergenic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1196371495 X:114984374-114984396 AACTGGGGAGGGAGGGAGCAAGG + Intergenic
1196537778 X:116867954-116867976 CAGTGAGGAGGGATGGATCAGGG + Intergenic
1197295771 X:124717306-124717328 GAGTGGGCATAGGGGGATCATGG - Intronic
1197489564 X:127100877-127100899 CAGTGAGGAGGGATGGATCAGGG - Intergenic
1197816006 X:130499427-130499449 GAGAGGGTAGGAAGGGAGGAAGG - Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198518667 X:137431198-137431220 GAGATGATAGGGAGGGAGCAGGG - Intergenic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199595766 X:149504835-149504857 AAGAGGGAAGGGAGGGATGAAGG + Intronic