ID: 1137743480

View in Genome Browser
Species Human (GRCh38)
Location 16:50803460-50803482
Sequence ATCCTGGTTGCACAGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137743480_1137743486 3 Left 1137743480 16:50803460-50803482 CCTTGTGACTGTGCAACCAGGAT No data
Right 1137743486 16:50803486-50803508 GAACCAGTTGTCAGGAGGAATGG No data
1137743480_1137743488 15 Left 1137743480 16:50803460-50803482 CCTTGTGACTGTGCAACCAGGAT No data
Right 1137743488 16:50803498-50803520 AGGAGGAATGGAGTTTTCTGAGG No data
1137743480_1137743484 -5 Left 1137743480 16:50803460-50803482 CCTTGTGACTGTGCAACCAGGAT No data
Right 1137743484 16:50803478-50803500 AGGATTGGGAACCAGTTGTCAGG No data
1137743480_1137743485 -2 Left 1137743480 16:50803460-50803482 CCTTGTGACTGTGCAACCAGGAT No data
Right 1137743485 16:50803481-50803503 ATTGGGAACCAGTTGTCAGGAGG No data
1137743480_1137743489 16 Left 1137743480 16:50803460-50803482 CCTTGTGACTGTGCAACCAGGAT No data
Right 1137743489 16:50803499-50803521 GGAGGAATGGAGTTTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137743480 Original CRISPR ATCCTGGTTGCACAGTCACA AGG (reversed) Intergenic