ID: 1137744645

View in Genome Browser
Species Human (GRCh38)
Location 16:50811916-50811938
Sequence GCATCAAGGACCTCAGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137744641_1137744645 23 Left 1137744641 16:50811870-50811892 CCAGAAAGCAGTGTAGAAAGTAG No data
Right 1137744645 16:50811916-50811938 GCATCAAGGACCTCAGTCACTGG No data
1137744640_1137744645 24 Left 1137744640 16:50811869-50811891 CCCAGAAAGCAGTGTAGAAAGTA No data
Right 1137744645 16:50811916-50811938 GCATCAAGGACCTCAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137744645 Original CRISPR GCATCAAGGACCTCAGTCAC TGG Intergenic