ID: 1137744645 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:50811916-50811938 |
Sequence | GCATCAAGGACCTCAGTCAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1137744641_1137744645 | 23 | Left | 1137744641 | 16:50811870-50811892 | CCAGAAAGCAGTGTAGAAAGTAG | No data | ||
Right | 1137744645 | 16:50811916-50811938 | GCATCAAGGACCTCAGTCACTGG | No data | ||||
1137744640_1137744645 | 24 | Left | 1137744640 | 16:50811869-50811891 | CCCAGAAAGCAGTGTAGAAAGTA | No data | ||
Right | 1137744645 | 16:50811916-50811938 | GCATCAAGGACCTCAGTCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1137744645 | Original CRISPR | GCATCAAGGACCTCAGTCAC TGG | Intergenic | ||