ID: 1137744850

View in Genome Browser
Species Human (GRCh38)
Location 16:50812983-50813005
Sequence CATGCCAAGGAGAAAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137744850_1137744855 8 Left 1137744850 16:50812983-50813005 CCAGTCCCTTTCTCCTTGGCATG No data
Right 1137744855 16:50813014-50813036 GAATTTCCTTCACCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137744850 Original CRISPR CATGCCAAGGAGAAAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr