ID: 1137746237

View in Genome Browser
Species Human (GRCh38)
Location 16:50822278-50822300
Sequence GCTTAAGCATGAGCACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137746237_1137746242 7 Left 1137746237 16:50822278-50822300 CCTCTAAGTGCTCATGCTTAAGC No data
Right 1137746242 16:50822308-50822330 CCCACTCCTGAGATCTTATTGGG 0: 13
1: 80
2: 290
3: 382
4: 342
1137746237_1137746240 6 Left 1137746237 16:50822278-50822300 CCTCTAAGTGCTCATGCTTAAGC No data
Right 1137746240 16:50822307-50822329 GCCCACTCCTGAGATCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137746237 Original CRISPR GCTTAAGCATGAGCACTTAG AGG (reversed) Intergenic
No off target data available for this crispr