ID: 1137747642

View in Genome Browser
Species Human (GRCh38)
Location 16:50834860-50834882
Sequence CAAGTGGACCAGAACTCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137747636_1137747642 9 Left 1137747636 16:50834828-50834850 CCTTTTCTACTGGGGATTCTCTT No data
Right 1137747642 16:50834860-50834882 CAAGTGGACCAGAACTCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137747642 Original CRISPR CAAGTGGACCAGAACTCAGC GGG Intergenic
No off target data available for this crispr