ID: 1137748487

View in Genome Browser
Species Human (GRCh38)
Location 16:50841129-50841151
Sequence CTGGGAAAGGAGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137748481_1137748487 5 Left 1137748481 16:50841101-50841123 CCTAGCCTTTCTCAATACTTTTT No data
Right 1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG No data
1137748480_1137748487 23 Left 1137748480 16:50841083-50841105 CCGTTTGGAGAGGGAGATCCTAG No data
Right 1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG No data
1137748482_1137748487 0 Left 1137748482 16:50841106-50841128 CCTTTCTCAATACTTTTTGATTT No data
Right 1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG No data
1137748479_1137748487 24 Left 1137748479 16:50841082-50841104 CCCGTTTGGAGAGGGAGATCCTA No data
Right 1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137748487 Original CRISPR CTGGGAAAGGAGAAGTTGGA AGG Intergenic
No off target data available for this crispr