ID: 1137748529

View in Genome Browser
Species Human (GRCh38)
Location 16:50841380-50841402
Sequence TACAGCGGAGGCGGCCCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137748529_1137748533 -10 Left 1137748529 16:50841380-50841402 CCGTGGGGGCCGCCTCCGCTGTA No data
Right 1137748533 16:50841393-50841415 CTCCGCTGTAGCAATTCCGAGGG No data
1137748529_1137748536 28 Left 1137748529 16:50841380-50841402 CCGTGGGGGCCGCCTCCGCTGTA No data
Right 1137748536 16:50841431-50841453 TTTGTTTTCAAAATGACACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137748529 Original CRISPR TACAGCGGAGGCGGCCCCCA CGG (reversed) Intergenic