ID: 1137748533

View in Genome Browser
Species Human (GRCh38)
Location 16:50841393-50841415
Sequence CTCCGCTGTAGCAATTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137748529_1137748533 -10 Left 1137748529 16:50841380-50841402 CCGTGGGGGCCGCCTCCGCTGTA No data
Right 1137748533 16:50841393-50841415 CTCCGCTGTAGCAATTCCGAGGG No data
1137748523_1137748533 8 Left 1137748523 16:50841362-50841384 CCGGTGCCGCAGTCGCAGCCGTG No data
Right 1137748533 16:50841393-50841415 CTCCGCTGTAGCAATTCCGAGGG No data
1137748522_1137748533 12 Left 1137748522 16:50841358-50841380 CCTTCCGGTGCCGCAGTCGCAGC No data
Right 1137748533 16:50841393-50841415 CTCCGCTGTAGCAATTCCGAGGG No data
1137748528_1137748533 2 Left 1137748528 16:50841368-50841390 CCGCAGTCGCAGCCGTGGGGGCC No data
Right 1137748533 16:50841393-50841415 CTCCGCTGTAGCAATTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137748533 Original CRISPR CTCCGCTGTAGCAATTCCGA GGG Intergenic